Description :
From Genome Similarity Track
Location :
Scaffold_678:4209- 7857
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_678-snap-gene-0.2Dynein heavy chain

Sequence
3648 bases(100 bases per row)
ACGCGATTCTGACGTCAAAGCCTCGTCGCGCGAGCTTCCGCAGTGCTGAAAACCAAGCTGAGGTGTGTGTGTGCGTGTGTATATGCTTGGGAAAGAGCAC
ACTTTTCACGATAGCTGACGTACTGCTGTGTACTTCTGCTCATGATTAGACGCTGAATATTGATGCAGCTCCGGGCGACACCCTTAAAAGCTTCTTCCAG
CCTGACACAGAAGCAGGGAGCATTCTGTTCTTCTACGTCTCGCACGAAGAGTACGAGGTTGAAGGTGCGTTGCACGCCATGGGTCTCATCGTTTCGAGAA
TGGTTTAGTTAGTGTCCTGATCGTGTATTTGGCATACGAACAGAGAACGTGGAGGAAGAAGTCGAGGTCGTGCGTGAGGAAAAGGCGCCAGGTAAATGTT
TGTATTTTTTTTTACTGATAATGCTAAAGTTCGTATCGTACTTGTGAGGTTGACTGTGCTCATCTGCGTTGTGTGTGCAAACGATGCGTCCCCGTAGATT
CAGCAGCAGCAACAACGGATGCAGTGGATGGAGCTGCTGCTCCTGCAGAGCTGACCGACGAGCAGCTCTTTCTTGAGGCTGTCGCGCCGCAACAGACAGT
CGGAAAGGTGAAAAAGATCACCAAGCGCACGCGAGTCGAGGTGAAGCAGGTCTGCAACGTGTACATGAATATCCTGCCGTCCGACTCAGTGTACGTGACG
AGCGTCTTTCTCATCAAAGTCGCTGCAGGACCGATCACGATCCAATTGAGCTCGAGCGACGCCCACGAGAGAATCCACCACGCGAACGTTGAGATTGGCT
GCTCAACGGGAGACCTGTTATCAAACCTGGAGGGCATTATCTCCCACGTGTTCATGCCGTTGCTGGACCCTCAGTTGTCGCATGATAACAACAACAACAA
TAGCAGCAATAGTAATGCAGGTGATATGGACGACCCAAGTGCTGTCAATGGAGGTGTGGCGCTTCACCAAGCGCTGAAGGTGATCGATGCTGTACGCAAC
GAATTCAAGAGCAACCTGGTAAAGTTCTCGTCGCAAATCACGAACGCAATCCAGCAGATCCAGGGCGACATCCACCTCAACATCCCCGACGTTGTGATCA
CCAAGCCCGAGTCGCACTTGGATGACTACGAGTTGATCAACACCCTCGAGCAAGCGCTTGAGGACTGGTCCAAGAGCGTAGCGAGTGTCGTCGACCAAGA
GACGCGCAAGATGCCAAAGCGCAAGGGGCCACTCGCAGAAATCGAATTTTGGCGCGAGCGAAACGCGACACTGAGTACGATCTATGAGCAGATCAACATG
GCGAGCGTGCAAAAGATGATCAAGCTCCTCGAGCTTGTCGAGGCGAGCATGCTACTCACGTTCAAGTATCACTTCTCGGAGCTGAGCAAGCTCTACATCG
AGGCAAAGGACAACGTCAAGTTCCTCACCACACTGGAGCGCCATTTCAAGAATATTGCTAGCGGCTCGTTCACGACCATCGCAGACACGCTTCCGTCGAT
GATGAACGCGATCCGCATGGTGTGGATCATCTCTCGTCACTACAACACGGACGAGCGCATGGTGCCGCTCATGGAGCGAATCGCGTCTGAAATCGCTGAC
AAAGTCGCATTCGAGATCAATATCCACACGATCTTACGCAAGAGCCCCGAGACCGCGCTCCACGCGATCGAAGAGGCGAAAATGGTGCTCGAGCTGTGGC
ACTCGACGTACATGAAAGTGCGGGAGCGCATAGAGGCGAGCGGCACAGACCACCGCTGGGAGTTTGACAGGAAGCGCCTTTTCGAACAGACCAACTACAT
GGCGAAGATCTGCGAGAACCTACAGGAAGTCGCGACTGTGCTGGACCAGTTCAACAAGTTTTTGGGACCCGAGCTCAAATCTGTCACGGGCGACTCGCAG
GGCATTGACGAAGTGATTGCGCGCGTCGACAGTCTAATCGCGCCTTTCGAGAGCGTCCCGTTCAAGATCTTTGACCGCGGGTACAAGACCAGTTGGGAGA
GCGTCATGGTGCAGTTCCGCGACAAGGTGTGCGAAATCGAGAACATGACGCGCAAGTTCATCGACACGTCGTTCCAGAAGCTTCGCTCCGCGGAAGGTGC
GTTCGACTTGCTGCAAAACTTCCAGAATATCCAGTCGCGCGAGTCCATCAACAAACAGATGATGGAGAAGTATAAGGACATCCTGATGCAGTACACGAAA
GAGCTCGAGAAGCTGGACGAACAGTTCCAGAAGTACAAACACAGGCCGCCCGTGTTCCGCAACCACCCGCCAGTCGCTGGTGCAATCAGCTGGGCTCGAG
CGCTGTACTTGCGCGCAAAGAAGCCGATCTTGCGCTTTCGTGCGATGAACGATCTCTTGAAGAGCCCTCTTGGCGAGGAAGTTAAGGAGAAGTACCTGGT
GTTTGCCAGAGCAGTCGACGCGTACATTAAGCAGCTGCACAAGGACTGGCGAGACAAAGTTCCAGCGTTGACGAACGAGTGTCTTAAGCAGTCGATCCTT
GGACCAAAGCTCATCGAGGCGGGTAAATCTGACACTGGCGTGATGACCTACAAGCTCCCACCGCCTCCATACTACTCGAATTTTGCGCCTGAGCTGACAC
TGATTATCAAAGAAGCCAAGTTCCTCGATCGCCTCGGATTCGAGATCCCAGAAGAGGCGCTGAACGTGACGCTACAAGAAGATAAGTACCATCAGTACGT
GCAAGAGCTCACTTTGATGCTTCGGCAGTACGATACGCTGCTCGCTGAGCTCACGCCCGTGGAGACGCACCTGCTGAAAACCCAACTGAAAGATCTCGAA
GACGTACTTCGAGTTGGGTTCTCGCCGCTGAACTGGAACTCGCAGCGCGTCATGAGCTTCATCGAGAACTGTAACAAATCCCTTAACCAATTTGCGAATC
TCGTCAGCCAGATCCACAAAAGCAGCAAGATGGTAGAAGAAATCGTGTTGGGAATTGAGAGCACGCTGCTGATCAAGATCGATGATTTCGAAGAGGGCGT
CGTGACGGAAGTGGGGGAATTCTACGAGCTCGTCGAACGGAATCGCATGCAGCGCATTGAAGAGCTGGTGCAGAGCTACCGCTCGATCGGCCCGCTGCTG
ATCAAAGTGGAAGAAATTGTCGCGGGCGTGAACACCGGCACAAGCCCAAAGATGGCGACGTACTACATGTACTGGGAGCGCCGCATCTTCAATGCGATCA
CGAAGATGATCATCTCGTCCATGACAACGTTCCAGGCGCTCTTGAATGTGCACACAAAAGATCTCAGCAGTGCAAGCAACGTCATGGGCATGTCCACGGG
AAGCGGCCTCAGCGGTGGCAACCGGAATCGATCGGAAGAAGTGAGCAAACTGAAGCGTCCACCGCTCTGCAAAGTGAAAGCGACGATGAATGGCAAGGAC
ATTGTCGTCACGCCATCGCTCTCAGACATGTATAAATATCTAAGCAAATCAGTGAAACACATTGTCGAAAGCGCGAAGGCATTTATTCGGTGGATGCACG
GCACGTGTCGCGAGACCGAGCCGTTGATCGTGAGCGAAGACGAAGAGCCTATCACGTTCACGTTCTACTCGGACATCTCGCAGAACCCGTACGTGATCAA
GATGACGTTGTCGCTAAACCAGGAGATCCACAAGGTGTTCAACATTGT