Description :
From Genome Similarity Track
Location :
scaffold_154:4209- 6097
Sequence
1888 bases(100 bases per row)
GTGAGTTTGACGACGCGGTGCGGTATGATTcctttgatcataagcgtccacgacgactGGGCAGTCTGGCCGAAGCGGCACTTCAAATTTCGACGAATTA
TCGAAGTCGGAGTATCATCGCCACTTCAAAAGATACTGGGCTTGACCATGGCGACGTCATCGACTCACAAGGCACTCTACATGATAGTAGACACCACCAT
TCCCGTCGAAGAGAGTCGGCGGTGGATGGGTCGATCGCTATCcgatgactcgcgatgctcttcgagttctTGAGAACGAGGTCCGTTGCGATCagggctc
cgctgagcatcatgttgGGGTCTCATATCGCTGCGCAAAAGACCTAGAAAGCTTGCAGCACGTTGTGCATcagctgcctcacgttgaggactgtcgcgct
ctgtcggagcgtcTTCTAGCTAAagagcagacaaatgcgtcGCCTCATGCAAAggtagagcgcttggcgccgctGGAGATGAGGATTGTTGCACTACCTG
TTCGAAACCAGTTGTTGATTCAGCTTCCAAATGTTCANNNNNNNNNNTCGTCAAGGCAGATGGTGTCCACTTGGGGCCATTGCCAGAGGTGTCAGAGATT
CTGAACCTCGAGGAAATGACGGAAGAAGATTTCCTGGCCAACCTAAAGGCCGAGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGTCAACGGGTCAAGCCCGCAGGGCATGCGTCTGCTCCGCTACAGAGCTTGTCCGTTCCAACTGN