Description :
From Genome Similarity Track
Location :
Scaffold_14:42084- 46142
Transcript NameFunction/comments
Phyci_557690Sulfate Permease (SulP) Family
Phyci_63246syntaxin, putative
Phyci_63247hypothetical protein CAOG_08783

Sequence
4058 bases(100 bases per row)
CGGCGAGGAGAGCTTCTACTCGAGCGCAGAGTCTGCTCTAGAGCTTTGCGAAAGTCAATTGCTGAGCCAGAGTTCCGATGCAGTACAGGTTCGCACTAGC
AGCTACCAGGACGAGTCTACGAACCTGCTGTTGCACCACTTCATCGGCGAAGACGAGGACGCTCAGCGGCAGTTCTTCCAGAAGCGCGAGGTACCTACCG
GTCATGAATTCTTCACCATTGGGGGATCAACCGACTCGTTCTACTTCCTCGCCCGAGGTTGCGTCGAAGTCACTGCAGGAAATGGCGCTCGCAACAGAAT
TTCCCCGGGCTCTTTGTTCGGAGAAGTGGCCTTCTTCAGCCGCCAGCAGCACCAGTCAACCGCAACTGCAACAAACCCGTGCATTGTGTTCGAGATGAGT
CGCGCCAAGTATGAGGCGATGCAGGAGATGTCGCCGGCGTTGTGCTCACGCGTTCGCGATGTGGTGATGGAGTCCATGGCAAACTCGCTCATCAGCAACC
ACAGCCCCGATGAAGTTGAAATTCGCGTAGCCCCCCAGTAGATAGAACGTCTAGTTAATTAAGAGTAATGAATGAGCACCGGCACACTTGTACCATCGTC
CTCGCCTGATGTTCGATTCGTTTCTGGTCGCTATAGATAGGCGAGCAATTGAGTGTGGGCACAACCGCTGCATTCGCAACTTCGCTGCTCTGGGAAAATA
CAACACTAATACTACGCCGCACCTCCAAGCCGCGGGGTGGGCGAGCAGGTGAACCACCGCCAATACGCAGCAGATATGCTGGATCGGCTCGCAGAAATCA
AGGGCAAGGCATCCCCGGCCGACCAAGTCGCCATCGATGTCCAGGTAGGCACTTTTAGCCTTCGAACCGCTTTCGTGACACGCAAAATGTGACCGAACTT
CGAACTAACGGGCGCCCGTTCCTTGCTACTATCTGCCAGCCGTGAGTCTACCCGAGAGCAAGCCATTTCAATTCTTGCCAACGCGTCGGAGGTACTCATT
TCGTATGCGTATATCATTTGGTTTAGACGGGGTGTCGTTCGACCGAAGTTCATGGAGCAGTTCTTCAAAGATGTCGAGGAAATGCAAATGGACCTCGCCA
ACATCAGGTACGAACGGTTTGCCGGACCCACAAGTTTGATCTCGCAGTGATTGATCCTGTTGCACCCTGCAGTCTCGCTTCGCAGCAAATTACCGAGTTG
AATGGCAAGGCGATCCTCGCTACGTCCAACGTCGAAGAGCAAACCATCAGCACTCAGCTCGGCTTCGTGATCGAAACGACCAACAAACTCGCCGCCCATG
CCAAGGGGTTGTTGGAAATGCTCAAGAAGGAATCTGCAGAGCGGAAGAAGGAGAAAGGCACGCCGCTTTCAGAGATCAGGTGCGCGATGAAGCTGGCGGC
TTGGTGATGATGATGGTTGTGCTGACCGTAGCTGTGCCATGATGTAGAATCCGCGATAATATGTGCGCCACCCTCACGAAAAAGTTCATGGACTCTATGA
AGGACTACCAGAAGGCCCAGCAGAAGTACAAAAGTGATATGAAGAATAAAGTGAAGCGACAGGTGCAGATCGTGAAACCTGACGCCTCCGAGGCTGAGAT
CGACGCTGTCATGCGATCAGGAGACCCCGGGTCGATTTATAAGAGCGCCATTCTGCAGGGCGGTGCGGCCGAATCCATCACCGACGTGTTTCTCCACTGT
CAGGACAAATACAAGGACGTGCTCAAGCTGGAGCAGAGTGTTGCAGAGCTCCACCAAATGTTCTTGGACTTAGCGCTGTTAGTAGAGCAGCAAGGCGAAC
TGCTCGACCAGATTGACCACCAAGTGCGCACGGCCGCCAACTACGTGGAACAAGGCAACCAAGAAGTGCAAAAAGCCATCAAGTACCAAAAAGCTCACCG
GAAGAAAATGTGCTGTCTGCTCGGTATCGGAGTAGCCATCCTGCTAGCAATCGTCATCATCGCACTGGTCCTCAAGAAAGCGTCGTAGAAACAAAAAGCA
TAACAACGATCGCGTGAGTAGCAAAACTATTAGCTGCAACATTGCTACCTCCTCTTTTTGCCAACGATCATTGTTCTGAGTTGTTGGCGTTTTGCTTCAT
TTCTCTCCAACGTGTCGGGGATAATCGGTCTACTCGATCGCCTTAGGTGCCTTGAAGACATCACCGATAGCGGACTTGAAGCAGTCGATGTTGTAATCAA
TGATTCCTTGCTTCATAAAGTTTTCAGCGCGCAGCAAACACACCAGAGCCAGATAGCTGCTCATGCAAAGTAAAACATGTCACAATGGGTGAGCTTAGCA
TTCCTCCGCATAAATAAGACTGTGCACGCCTTACTTGTTGACTTCACGGAGGTAAAGCACCATTCCATTGTTGAGCTTGATCACCGACGACGACTTGGAG
TCGTACGCCAGGCCGTCTCCCTCGCCGTCATCTTTCATTCTGTCGAAAAGACCCGCACATCAGAATCTTATCCAAGTGCACTTCGGTACCTCGCAAACTC
TACTCACCCATAAATGCAGGACACGTCAATGACCACATCGATCATGTCGCTGCACAGCTCATACGACTGCATGTCGACAGGGTTGCTGTCCGTTGCAATG
TAGACCTTGCTCACGACGTCGAACAGGAACGACTTCTCCATGTTGCAGCTCTGAAAACAGACACCTCCATTTGTCAGCAGTCATCCCCTTCCAACAATCG
CCATCAAGCTTAACGCACCGTGATGAGAATGTTGAGAAGATTCTCGAGCGTCGGCAGCTGCGGGATCAGCTTCTGCACGACCTTGCTGAACGCCTCAAAG
ATGGAGTGGTCGTAGATGCTGGTCAGGTAGAAGCTCATGTGGATATCCAACTCCCCGTCGTTGATCTCGTCCATGATCTGCTGCTGAATCTCTCGCTGGC
AGTCTGTCCGCACAACACACACCTTTGACTTCAGTATCTCGCAAAGATCCCCCCTCCCCGAACAACTCTCTAAGCCCCCGCCTACCGATCTTGTGGTCGT
CCGACAGGAAGAGGTCGCCGTCCACCTTGTGGATGAACACCTCGAACAGAATGTCCGGGTTGTACCGGTGTGCACGCGTGACCGTGTCGTGCAGACGCGC
CAGCGCCTCCGCGTAGGGCTCGTCCTGCGCGTCAATGACGAACACGATGGAGCCGCAGTTGCTGAAGATCATCTCCTCGTTCACGAGTTGGCCGCCGTAC
ACCAGGTCCTCTACGAAAACCAGCCACCGTCAGCCACTGCCCCGCGTAGGTAGAATCCCCACCCTCCCCGTTCTACCTTTGAAGTCGTAGTCCCCCGGGA
AGTCCCAGATCTGGAACTGCACGAACGAGTTGTTGGCGATGTACTTGATGTCGAGGCTGTTGGTGCCCTCGAGGAAGAGCGTCTCGTGGGGCGACATCTT
GTGGAACACCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN