Description :
From Genome Similarity Track
Location :
Scaffold_525:4207- 8395
Transcript NameFunction/comments
Phyag_g6380hypothetical protein

Sequence
4188 bases(100 bases per row)
TCGTGCAAATCCATCCAACTGAACACCTTCACCAGCGACCAGCAtgctgcagacggagacgcagcgaGGAACTTccgcgccttcttgccgccaaACTTTC
GGTTCGAAACCACCTTATCGTGCCAGAATCGAGCGCCGTCAATACCCTCCATCTCGATCTTCAACGATGCAACTGCAGTGCTGTTACCCTCTGCGTTTAC
TCCACTTGCTACGAAGACAATGGCATTCCTTCGCAATGCCAGTTTTGGCTTGTCCTTCGGCTGAAACGGATTGAGCAATGCAACGAGTTTGCTCCTTGCC
AACTCCACTCGCTTCTCCAGTTTCTCTCGATCTTCCAACTCCATGCGCTCGATTAGCGCCATTGCTTTTGGAGGTGTTGAAACGCGTCTATTCAGCACCA
CGTTCCAATACTCCATTTTTTGCTCTCGCTTGTCGTACTCGGCCACCCACGCATATTGTGCTATACGGTTGAATTCGATCGTTTGCAAGTACAACAAACG
AGTTTTCCGAATAGCTCCTTCCAGGATCTGCAAGATTTTGGCATGGAAATCTCTCGTGACATTTAGCGCCACTTGTCGTGGTGATTCGTATGCTTGGCGC
AAGGCTGCATCTTGGTCGTACGGTTCGATGTCCTCAAAGTGAACAACCGCAGACCGGTTGGCAATCGGGACGAAAACCAGTACGTTCCCGGTGAGCATCA
AATTCTGCGTCGATAGGATTGATCCCACACAATTCTTCCACTCGCCCTTCCGGATCTGCACCTGTTCGTCGTAGTTACACCATGTTCTGGCAGCCTCCAA
CGCACGAGCTTTTTGGTTCTCACTCCAGCGTTTCTTGGCTGGTTGAGAATTGTCAACTGGTAATCGTTGGAGGAACAGAGTACGTTTGATCGTATCAAAC
CGCTGCCTGCGTGCTGCAATTTCTTGCTTTGTGTCTGACTTTAACACCGGCGATACACCAAAGACCGCTTTCACCTTGTACGTGATGGATGACCGCACTT
TGTCATCCTTTTTTCGTTGTgctcgcgcagcttgagTTTGCCGCACTAACTTCATGTACGCCTTCCCGGATTGACGTGCAAGGAATGATCGAATAAGCGC
CTGAATTTTCGTGGCAGCAATATTGTGTCGTTTGAGTTCtgtttcttgctgctgcctctcttgttctcgctgtgtcttcctcctctctcGCTCTTTCTCG
GCGTCGGCATCCCGCTTTTGCTCTGCTTTTTGTCGAAGGATGGAAAAGTAATTCAAGCGATGGCAGTGatgatgttgtcgctgccCTTTAGCATGGTAGG
AACTCATACATCGCTTGCAAAATACGTCTAAACAGGTTTCGCACGACCACTGAGCAACCCGATGAGAACACTCAGCGCACATGACCACCAGAGCTTGAAA
CTTGTGTTGGCTTTCCACGAGCTGATCTTCAACCACGTTGAGGTCTTGGTTGGCCACTACCCCGCCTGGGGTCACATTTTCAGTTCGTTttgcctgctcc
agcagttgctTGTGAACGTGCGGAAAGCAGGGGTCACAGAAGGGAACTTTGCCATTTCCGCATTGAAGACACTCCCTTGTTGCAGTTTCCGATCGGCAAT
AACTGCATTTTTGGATGTTCCGTGGCTGATGTTTTTGGAAAGCTTTTCGGGGTTTATGATCCCTATCAAAGCAGATTCGGCACATGACGTCTTCACACTC
CACACAGTACACATCCGCTGGAACTTTTGAAGCATTGGGATTCGTACTGTCTTCATGGCGTCCGCAAAATGCCTGGAATTCCTCACCAGGAAACGGCAAT
GGAACAATCTTGCCGCATTTTACTCCTTTCAAGAAAACCGGACGCTTGGTTAAGATTTTCCCGCTAGCAATGTGCTGGAACTTAACTGCACGACCTTTGT
GATCAATATGTTCAATAAACATGCCGGCTAGCATTGCCTTCAGCTGCGAGCGAAACTTGTAGCAACGATACGCGATTTGGATTGTCGAAGCGCAGTTACT
CCGATGCGCCTGAATTTGCCGCTCACGAAAGATAATGGCAAACTGCTCGTGTTTCTTTTTGGTCGCGATTCTTCTGGCAAACCGCCGTAATACTGTCACG
GACCAAGTCAACCGTTTGGTGCAGTGCGTGCCCAACGTTTTCCTGTATTTTCCATTCTGAATAGTAGACGGCAGCACAAAGCGATTCATGAACCGGAGGA
AATGTTCATCGTCACGAACCGTATCGGTAGGCTCTGAACCTTTCACGGCATCCTTTTGACTGCTCTTGCCTCCAAATTTCTCTTTGAGCACCATTAGTAT
AGCCTTGTTAAATCTCGGATACGAGATTGTCTTCGCCTTCGGTTCTTTCATTTTCGCGAAAATAACATCAGCGTTCTGCATTGGATAATTGGTCTTGTGG
ATGAACGCGTGTGGAAGAGCCTTTAGGAATCGCGCGAAATGAGAATTATCCATTTCCAGCGAATTACCAGCGGCGTTCCGAAAGACTTCTTGCCAAATAC
CGTCATAGCCTTTTCGTgtccacagcttcttcgctaGGTCCACTGCAAAAAGTGGTCGATCAACACGGGATTCCTCCTGTGTATTCCCTTCCTTCTCGTC
TGCAATTCTACCCGATTTGAAAGTAAAGCTTTGTAGCAGTAGCTCATCCTTAACACGGATTCGAGTCCCGTCCTCCAGGGCTTTGCCCACAGCACCCTCT
TCTGCGAGATACTGACGACGTCGAACCACTGCAGCTAACATTCTTCTTCCGATAAATCTCCGTGCCGCTCGCTGAATAATTGCAGCATTTAATGCACGGA
ACCGCTGGTTCTCAGTATTTCGCCGCGCTTTCCAATGTGCTTGAACTCGGATAATCATCTTTATGGCGTATCTCGTTTGCAGGAGTTGTATCCGAGTTTT
GTACCCTCTCCACACTCGTTGTATACGTCTTGCACTCCTTGCTAGCATTACCCGCCATGCATACGCACGCCCTCTTATTCCTCGAATACGTCTCTGTATG
CACAGCGCCGCAAGTCTTCGCTTTCGATTATTTTCACGCCGCACCCTCTCCATTGCTCGAGCTTTTTCATACCGAAGTCGTTTACGAATTTGTACGCCTC
TCCATCTCGCCTGCAGCTTTCTAGCAGCTTGAACCTCTTGTGAATTTGAGGCATCACGTTGGTATGTATTGGCAGCTTTCAATAGCGAGACTTGATCCCA
CTTCTTCTGCAACTGTATCGGACTGAGGATATTAttcttcctgctgcggcGATTTTCCTCGATTTCTTTTAATATTTGGTCACGTCGAGCCAATGCTTGT
TGCTTCCGGCTCAGTAGCTCGCATCTGGCAAGAAAGCACCTCCACGAACACTGGAGTACAAGAACAGCTCTGCGAACATCGTGCTTGTGCTTAATTGCCC
ATCTGCGCGCTTGTTGGCCTCGATAGTGCGCTTGAACCTTGAGTATTTTTTTCTTGTCACGATCAAATgttgcacgacgacgacgaagctttAAAatttg
cttctgctgccaaTCGCGAAATGCACGCTGTATCGAAATTGCAGCGCCAAGCATTTTCGTATTCCTTGCTCTCACTGCAATACCAAAAGCCTTTTGTCGC
CGAGATTTATCGGCATGGTCAATCTTGGTGAGCAAAAGTCTTCTTCGCTGAGCCAGTATCCGCCGTGCATGCTTTTGAATGCAAATGGCTGCTttgtgct
ggcgctgccTGCGGATCTCTCGACGTAGAGCTATCCACTCAGCGCATGATTTTCTCCAAAACTTTTGTATACACGTTGCAGCCTGCAGTCGACGTTTTGC
TTGTTCACGCAATAGCCGAAGCACATAATGTCGTATGCAGCGCGTTATCCGGCAGgccgcttgttgctgtttgcttGCAAGTAGAGCTAGAAATGCCTCT
TGTCTGCGTTGCAGCTGGTTGCGTattcttctccgtcgtgcAACTTCGTTTTTCGCGCTTATctgccgccaccagcactgTAGACGTTCACTAGCCAAAC
CCCATTCTTGTTCTCTCGTTGCAAGGGTAAACTCTTTCCAACGACTCATTCCTAGGACAAGTAGTTTATTTTTTAACCGAACTCCAGCGCGAAATAAGAC
CTCAGTAGCTCGTTGTTGAGCTGGCGACGCAAATTTTCCAAGTCCACATGCGTAAATCACATCAAGCGGGATCCACTGCTTGATTTCA