Description :
From Genome Similarity Track
Location :
Scaffold_5:42063- 43487
Transcript NameFunction/comments
Phyci_264753Hypothetical protein

Sequence
1424 bases(100 bases per row)
ATGCTTTCTGTTCGATCAATTGCAGCGGCGACCCTGGTCTGCTCTCTCCAGCTCTCTCATCTACTGCATGCCAACGCGGATTCCACAGTCAAGGCGGATG
CCGCTACGACGCTAGTTGGGTCCTGGGACGGATGGGGCACGTCGCTCTGCTGGTGGGCTAACGTATTCGGTGATCGCGAAGATATCGCCGACCTACTTTT
CACTACGAAGGAGACCGTGACGCTGAACGGCTCCACATCTAGTCTGCCGGCGCTGGGGCTCAATATTGCGCGTTACAACATCGGCGGCAGTGCCAACAAC
GTTGTCGACGACAGCGGAACCGAGGTCTCGATGAAGGCGTCGGACAAGATGCCAGCGTTCAAGTTTATGGAGGCCTTTTGGTTGGACTGGATGAGCAAGG
ACCCTACGAGCAAGAGCTGGAACTGGGATGCCGATGTGAAGCAGCGCGCAATGGTCGGCCTTGCTACTAAGCGTGACGTCAATATCGTGGAGGCGTTTTC
CAATTCACCGCCGTGGTGGATGACGAACAACCATGCCACCGCGGGCGGAGACGATGGTGGCAAGGACAACTTAGAGGACTGGAATCATGATCAGTTCGCG
TTGTACTTAGCCACAGTGGTAAGCCACGCCAGGACGAGCTGGGGCATTAACTTCACGTACGTCGAAGCCTTTAATGAGCCCATGAGCACCTGGTGGGAGT
ACCCGGGTGGTCAAGAAGGCTGCCATTTCGAGGTTGACACGCAAAAGGATGTTTTGGTAAAGCTGCGTTCACAGTTGGACACTCTTGGACTGAATGACGT
GGCGATCTCATCGTCCGACGAAAACTCGCCCTCGTTGGCACTCTCGACGCTCACCTCCATGTCATCCGACACCGACGTGATGGCTGCTATCGGGAAGGTG
AACACGCACGGCTACGACGGCCAAAGCCCATACCGCGGAACCGACCGAGAACCCTTGAAAAAGCTAGTGACCCAGTCAAACAAAAAATTCTGGGATTCGG
AGTATGGCGAAAACGACGCAACGGGGCTGAGTCTGGCTGAGTCGATCGCTCTTGACATCAACCAGATGGGTGTGTCTGGGTTCGTCTACTGGCAGGCTCT
CGACAGTGGAGCTTGGGGCCTCGTTCAATCCAACCCGGGCGATAACTGGATCGGCACGCCCAACCCCAAGTACTACGTGCTAGCACAGTACTCACGCCAC
ATTCGACCCGGCATGACCATCTTGTCAACGGACGACACCACAAACACCGTGATGGCGCTCGAAGCCACCTCAAAACTACTAGTGCTCGCAACAGTGAACA
CGGGGGACTCGGCGTCGACGGTCACGTATGATCTCTCCAGCTTCAAGACGGTGGCGGGTCCGATCACTGCTTGGACTACGGAGACGAGCGGTACAGGCGC
GCTTCACGAGTCTTCAAAGGTCGA