Description :
From Genome Similarity Track
Location :
Scaffold_36:420603- 429456
Transcript NameFunction/comments
Phyin_T30-4PITG_14619Putative uncharacterized protein
Phyin_T30-4PITG_14620FKBP-type peptidyl-prolyl cis-trans isomerase%2C putative
Phyin_T30-4PITG_14621Putative uncharacterized protein
Phyin_T30-4PITG_14622Putative uncharacterized protein
Phyin_T30-4PITG_14623Mediator of RNA polymerase II transcription subunit%2C putative
Phyin_T30-4PITG_14624Putative uncharacterized protein
Phyin_T30-4PITG_14625Methylosome protein 50%2C putative
Phyin_T30-4PITG_14626Dual specificity tyrosine-phosphorylation-regulated kinase%2C putative

Sequence
8853 bases(100 bases per row)
TCAAGCATCCATTATAGCAGGGTCAAGCAGAAGTGAAGGGATTCCACTGCCACTCTTAAAAACGACAACGAAAAAGGCAACTACGCGCACAATGTCGATG
CAATCGCTGGCCAATGCTGCCTATATGACGTACTTCCTGGCGGCCAAGTCCGTACCTGTCGTGGCCGTGGGCTCGTCCATCGTGTTTGCCATCTCCCCAT
GGTGCGTCGTCGTCCTTCTCTCCGCATAATGAAGCGAAATTTTACTAATACTTACCGTCGTTCTTCATTTGACAGGCCCACGGTCGCTACCATCCGTCGC
GAGCGCAGCACGTTGCAGTTCTCATTCGCCCCATTCTTCTTCTACTTCGTGCAGAGCTGCATCTACACATTGTATGGCTGGACGACCGGCAATCCTGTGG
TGGGCGGCACCTCGTTTCTCGGCGTGGTGTTGGGCTCGTACTACGTGCTGATGTTCTACACGCACGCACGTGACCGCACACAGCCCACCAGGATGTTGAC
GTCAGCTATGCTGGTCATTCTCTTGCTAGCTCACCAAGTGGCCACGCGCTCGCCTGAGGAGACGCAGATACTCACGGGCATTCCGGCCAACATCCTGTCA
GTGTTCACAGCTGCGTCGCCGCTGCTTCAGCTCAAGAACATTCTTCGTCGCAAGGACGCTTCCTGCCTGCCTTTTGGTATGTCGGCCATGAACGTTGTGG
CTGGCACCATTTGGTCCATCTATGGCTTCATGTTGGGCGACCCTCTGGTCATTTGTCCTAACTTGTTCGCACTCACGATGGGTGTCATTCAGGTGTCGCT
CATCTTGCGTTATCCGGGAGGCAAAGCCGCCGGTGCAGCGGGACCCAAGGCGAAAACGTCGCCACCTACTAAGCCAGCGACGAAGGCCAGTTCTCCACAG
AAGAAGAAAAGCGAACACCCGGAATGAAGTGGACGGCGAAAAGCCTTAAAGAGAACTCGACCTGGTTTTAATCGGATTTATGAAGAAGCACGTAGCTTGT
ATCCCCGTTATGAAATACATTGGCTTTTGATGCTTGAGGTGTTGCCGTTGTTTATTTTCGGCAAGTCGTCAGCAACTCGACCCTTAGGAAGGAAGCGAGC
TAACGGGGCATCATGATGGAACCCAAGGACTTTGTGATCTCCAACACTGTGCGTTCATTCATTCACCCGTGCTACGTGATAGTTTAATATACTCTGGACC
TCTTAGTAAGAGTACGTCGCTGTCTGCAGCGCCCTCGCGAGATCCAGGTTGAAGTGTTCGTGGCTGGCGATGGTCTCAACTATCCGAAGAAGGGTCAGAC
TGTAGTCATCCACTACACGGGCTACGTACGTCTGTAGTGCCGGCAGCTCTGTGTTCGTGTTTACTCTGCTCCTGTTTACTCACCACTTTTTGCTACTTTC
AGCTCCAAGATGGCAAGAAATTCGATTCGTCTCGAGATCGAGAGAAACCTTTCAAGTTTAAAGTCGGCGCAGAGCAAGTGATCCCTGGACTGGACGAAGG
AGTCGAAAGACTGTGTATGAAGGAACGAGCCAAGTTGTTTGTGCCTGCTGACAAAGCCTACGGTCGCAAAGGTTTCCCGGGTCTAGTGCCGCCCAACACA
AACCTCATCTTCGACATCGAGCTGCTGACATTCCGTTGATATGATAAGCCAGCGGTTAACTTTCATGTACTACCTCCTAGCTACCCGCAAACAGCTCCTT
CTTCTTCCGTTCAAACTCCTTCTTGCGCGTCACTTGAGCCTCACGAGCGTCGAGTTTTGTCTGGATGTAGTGCAGCTGAGTCAGGTGTCTGTCGGCTGCC
TGCTGTGCTTTCAGCTCTTCTTTCCGTTGGAGTGCAGTTAGCTCCTCGTAAAACTGAGGCGTCACAGGAAGCGGCTTGGCGAACTCGTCCTTGATCACTT
GCTGCATGCGTAGGCGATGGGCCTTGTTCCCACTCTTGGCGGCACGGATGAACTCGTCCCTTTCCTGGAGCTGCTTACTGAAGCGAAGTGTGCCTTGAAT
CTCCCGCTCGTTGCAGATTTTCCTCCAGTTGAGATTCGCGATTCGCTCTTCCAGCGAGGCGAACGCCGTCGGCGATATACTCTGCTGCATTTCTTGCCGT
GCGAGAACCACAAATGCCCTTGCCTACTTCATGATCCATTATCAGAACGTCCTAGGGCATATTTTTAGAGATGTACTCGTCTTCAAGCCACATGTCGACT
TCAAAATAAAAGTTTACAGCGTGTTGAGAACCTCCGAGAAGCCGGGAATGGGGTTTTCCCGCACATACCACATCAAGTTTGGGTCGCTGGCTGTAGCTGT
AGCTGATGCCTGGCGTGATCCTTCTTCTATATCGCTCGAGACTTGTTGCGAAGCTGACTGTTGACAGTCGTGTTGCGGTTTACTGGCCGCATCATCACTT
ATCACGATATGGTGCGTCCGTACACCACGTTTATCCTTCGGAAGGCGAAGCTTGAAGTGTTGCTTCGGAACGAATCCTGGGATACGTGTAGACTGCCGCT
CTGCTAATACCGCGATGTGCAGCTTTGTTGCCGTCAACACACTACAGAATCAACAACAGAGCGAGCGATCAGCCTCTCGCCCACTTGCAACAATTTCAAA
TATCCGCAGTAAAATTTACCTAGAGAATTGCTCAACTGCATGGGAGAACACTGCACGCATGAGTTTCTGAGAACACAACCGCATCAGCTTCTCTCTCGTA
AGCGGCGGCGAAGGTGGCGTCAGTGTTTGTGAGTCTTCTAGTGACATATCTTCCTCGTCTGTAAGCGGTGAATATGGAATAGAGCGCGTCGTCAATCCCG
CATCCACCGCCTTGACGTCAGCCTCGTCAAAATCTACAACGACAGCCTCCCGTGGACTCATCATCGACGCTCCAAACACCAACAAAACTGCAGGTCAAGT
CAGCAACATGATCTCGAATACAGCAACGCCGTCAGCTAGCACCCACCTCTCTTTACTCTCAGAGAGAAAATTGCGTCCAGTTGTTCATTGAACAGCAGCT
CAGCAGCATCCACACATTTCATCGCCTTCTTGATACCTCCACTCATGGGCAGCCTTCAGCAGCAGGTAGAAAACATTTAGTCAGCTCCAACTTGGCCCTA
CTACTGTTTCAACAGCTTCGCACCTTCTCCGCGTTTGTGTTCCCGTCTCTTCCTGTTGCAGCTGCAGCTGACGATTCTCAATGAACTGCAGCAACTCGTC
GTAAAGGCTGCAGCATTGGTATTCCCCTTTAGACACGGCACCTACGCGCTGTTACGACGCAAAGTTCTGGTCGATACGCACCACGGGATCTGGCCACGCA
TGAAGAGGATGTATTTGGTAAGCTGTGTCGTCATCAACGCGCGTAACTCGCCGTCAAGCGCGGTTTGATACGTCACGTGCAGCGCCTCCATAATTGTGAA
TCAAAGTTGCAAAGTTGCAAAACAAATCGGCGACGAAGCTTTGGTGCAACTTAATGAGATGAGCAACATAAAACTCCCAGTTTTGAATTGTTGTGGGGAA
GATGGAAGTGTCGGCGCATGTGGACGACTACAACGCGTCTTTCAGGGACACGGTGTGGCTGCAGTCGTTCCCTTTGAACGCACAAACGGTTCTCCACTAC
TTTGCGCTGTCTCCGTTCTACGACCGCTCGTGCAACAACGAACGTCTCAAGATGCAGCGTCTAGGGCTCGACCAGCTGAAGAATCTGCGCGGTGTTGAAT
ACGAGCTACTACCCAATACAGCAAAGCAGATGCCTCAGCAGCTTTTCATCATCCGCAAGCAGAGACGTAGTGGTCGCACGCAGGTGGAGCCACTGGCAAT
CTATTACGTATTGGACGGCACTGTCTACCAGGCCCCGAACATCCACGCCATGCTCACCTCTCGTCTCGTACGGGGAGTAGTCTTGAGTACTAGAACTATC
ACTACAGTACTAATATGCGATTGATATGCTAGAAAAAATGCAGCTACCGAGTGAACAAGGCGTTCCACGGGCTTGCAGCGGGTGTACGCTTCAGCCCCAC
AGAAGGCTACGCGTGGGACTTCAGCTCCAAGGACAAGAAAGAACCCGTCATCCCATCTGAGCGTATGACAACGCCATTAATTGAAATTCCTCTTAAAGAC
ATCCTGACGCTTGTCATGTTTGTTCCGAGTAGAATTACAGCTCAAGCTGAAGCAGAAATACGAGAAGATGGAAAAACAGCGCGAGAACTCGGCGCGTGTC
GACTCCATCTTGATCCAACTCATGAAGAAACACGCTCCGGAAATCGCAAAGAAGTTGGAAAACAACAACGCTGCAGCAACTGGAACAACAGGTCCAGAAG
ATCCAGCCATTAAACGCGAAAACGACGCTGGCGCGGAAGCTGCCAAGCGACAAAAAGTTGCATAAGAACCCACCCACTAATGCATCGCTAATAATTTTTG
CACGATGCAACTTGTCTGCAAAAGCAACTTATATTGCAGGTATACAATTATCCAACTGCGCTCATAAAGAAGATAAAGCTACTTAAAAGCTGTGCGCAGG
ACCTCCCCAAACGTCCAATCTCACTGGTCCTTCTTGTTCTCCGGTCGACCGTAGGTGCTACGTGCCTCGTCCAACTTAGCGCTTCCGAGCTGCTTTCCGT
ACTCGATCTTCTCCCCAACGCTGTCCGCGATCCCTTCCATTTGCGACTTGAGCTTATCAGCGGACGGCATCTCACGCGCCAACATCATACGCGGTTGCTT
CATCTTGTTCACACTCGCATTCCACTTCTTGGGGTAGCGACGACGGAACATCATCAATAGGAAAATTGCCAGCAATGGGATGGCGAAAAACGCAGCGTGC
CGAGCACAGATACGATCGGTAGGCAGCGGCAGGCAGTACTCTCGCTCGCCGACGTTCTTCGCAGCCTCGGCGCTCTGGTGCCATGTGTCCTTGGCTTTCC
CACCGGCAGTCTGCATCGACTGGGCGACACGAGCCTTGACACTCTCGACACGTTCGCCCAGGTCAGTAATCTCTTCACTGAGCTTTTCACTCGCCGTCTT
AAGCGAATCCATGACGGTGTCGCTAATCTTGTCGGTCGGGACTGGAGCAGAGTTCGGCAGACCGGTAGATTCCTTAGCCGAGGCCGCCGCTTCACGCATC
ACTTCGTTCATGTGATTCATCTTCTCTTTCGCGTACTCGCCGAGGTTCCGAGCGTCTTCTTGAAGCTGCTCCAACGTGCGACGGCCACGGTCGCCCAGGT
CACTTCGACGGTTCATCTTCTCCGCCTCGGACAGCATTTCGTCCATTTTTTCGGTCGCCGCCTCCTTGGCTCCGCGGTTCTTGGAGATGTGGCTCTTGGG
CATATCCGTGGGCATTCGCATCGTAGCTGAGAGTTAGCTTTCTCAAGTTGCTTGTACTGGTTCGGGTGCTAGACTGCGCGTTTCGAAATGGCACTTGACG
GAGTGAAAATGTTGCCGTGGAGACTGGGACAAGGAGGATGGCAAGAAAACAGCTCCCAACTGTCGTGTTCAACCACCTAGTAATTGGCAGGTCCCAGTCA
GAGACAATAGGAGCGAAGGGAGAAGAAAAGCTCTGACAGGTCCAGCCATTGTTGCCTTTTACTTCAACATGGTGTCTGACACACTATAAATTATTTTATT
CTCGGACTCCGATAATAAGATGCCTAGCGGATTCCGAAAATTAATTTGTTGATCCAGTGATGACCATGACGAACCAGCACCGTTCCTTCTCCTCGGCAGC
GCAAGTGGACGCTATAGCGGCCTGCTCGCTGCCGAACGTGCTGTTTTCGGACGAAGACGAGGACGCGGAAGAGCCGGAGTTGCCCCTCCTAGCGGTAGCG
CAATCACAGCTTGAAGGCAATGTCTGGAGCGGCGGCGTGGCTCTATTGGATGCGGCATCGAACGAGCGGCTATGCGAGTTGCAACTGGAGACAGGAGTAG
CGTCGTTGGCCTGGTGCAGCGCAGAAGGTGACGTATTGGCATTGGGCTGTGATGACGGCGACGTGCGTCTGGCCAAACTATCGACGGACGTGACGTTCGC
TTTTGTGCCACTTGGCACTGGTGGCAGCATCGACGAGGACGCCGTGTGCGGCTGGGGGCACGACGATGTTGTTACGGGCGTCAGTATTTCTTCCGTCGAG
AAGACACAATTGGCTACGTGCAGTTGGGACCTCACGGTGAAACTCTGGGATATTGGAGCCATGGACAAGACGGTCGCCACGTTTGACGGCCACACGGACT
TAATCTGGGGCGTGGCGATGAACCCGACGCACGCGAATTTGCTGTGCTCGGCTTCGCAGGACTCGACGGTGCAAGTGTGGGACGCCCGGCGACCTCAAAG
CGCTGCATTGGCAGTGTCAACTCTCCTGCCTGCGCTGTCAGTAGACTGGCATCCGAGCCAGTCGACGGTATTCTCTGTTGGACTGGAAGGCGGCTTGGTC
TGCACCTTTGACGTACGCTCGCCGCACACGCCACTGTCTCGACGTGAGACCCACAAAGCTGCTGTACATGTCGTCAAGTACTCACCCTATCATGATGACT
TACTGGCGACGGGAGGTGATGACGGCAAAGCCTTCGTGACAACCGACAGCTTTTCGTCCGACCGAGCTGCAGGCACTGGCGTTCGTGAGCTGCTGGTTGG
CGAAGAGAAAACAACGCCACACCGTGACTACGTTCGTGCTCTAGACTGGTTCCAGCTAGCGTCAACGCCCTCCACCGACAAAAGCTTCGATACGATGCTC
GCCTCTGGTTCGTGGGATAAAACTGTGCACATGTGGAGTGTCGACGACTACACTGCTCCTACCACGAACACATCACGTTCGTCAACAAACTCAGGAGTGA
CGGCACCGCCAGGAGTGTTGGTCCCGGTCGCGTAACAAGTGGAAAATTGTTGAGAATTCGTTCCTTTACATTTCTTTTTCATTGCGTTAGATAGACACCG
CAACTTCTTATAACTCATATTCTACAGGGTTGACGTGGTGAAGTATCCAAGGTTCCTGAAGAGCTTGTTCAGGAGTGAGACGTTGACTTGGATCCCAAAC
GAAACATTTTGCCAAAAAGGCCAAAAATTCCGGATCATCAGACTTGACAGCGCCGACAAGACTTCGCGATCCCGGCGAGCGTCGACGACCACGTGAGTTC
ACGAACGCTTTGGGTGTGTAGTCCACAGTGTTGATATCCGCCGGGTTGGCCACTTCATCGAAAAAGTTTAGCCGTCGCTTGCTATTGCGCACTATTTCAA
TTGGAGGCACATCCAGCACCTCCATGATACAGGCAAACTGTTCGCGCTCGTTCTCACCGGCAAAAATCGGATGACCCGCGTGCAACTCGACTAGGATACA
GGCAAAACTCCACATGTCGATAGCACCAGAGTACATGTGGCCAAGCAAAACTTCTGGACTGCGATAGAAGCGACTCTGGATGTAGGTGAACATGGGAGCT
CCTTCCAGACAACTACTGCCGAAGTCGATGAGTGTCACGTTGTCCACGATGCCATTATCTCCTGGTATAGTCGTCGTATCTAGCAGAATATTCTCAGGTT
TGAGGTCGCAGTGGACGATCTGCTCCTGTTTGAGGAATGCCAGAGATTGGGCCAATTGCTTGCCAATTGTGCGTACACTGCGCATGGGGAGACCGTGGAA
GTGACGCAACTTGAGGAAATCGTACAAGTTGATGCCCAGCACCTCGAAGGCGATGCACACGTGGTCACGGAACTGGAAATATTCCTCCATGCGCACAATG
TGCGCGTTGTCGCCACTACGTTGGAGTTGTGTCAAAAGTTCCACCTCCACGAGAGCCTGGTCGCGGTATTTCCGTCGATTACGAATGATCTTGACAGCGA
CCTGTTTGCCAGTGCGATGATCCAGACAACACACCACCTGGCCGAACGATCCTTGACCTAATGCACTCAGTACTTCGTATCGGAAGGCTAAGTGGTCTCC
TATCAAGACCAAGTAGTCTCCGCGCTCGTCATCGTAGCCGTCGTTGCATAATTCGGTACATGTAGGAAAGTCGTCTGATTCCTCTTCAACGTGAGCTGCC
GCCTCGTCTCCGTGTATTGGCAGATCGTTCTGGATCTTGCCATTGCGGCGATTGCGCTTGACTGCAAGTGTCGACACGAAGCGGATCTCGTCGCACTGTA
AGATCTCCGCCCGCTCCAGCGCCGTGAGCTCCGCTGCTTTTTCTGTATCCATCAAGAACTGTTGGCCAGTCGGAGGACATATCTCTGTTGCTGTTTCTGT
TCGAGTGTCTTGCTCGTGTTGCTTCCTCTGCTCTGTTTCGGCATCTTCACTGAGTCGCAGTCTTCGTTGCGGCTGCGGTCTGTTGCCTTTCTCTTTGTGT
TGTAGTTGTTGCAGTCTCCGTCGCCCGCTCTTGTCGCCGAGAGGACGATGTGGCTGCCAGAACTTGCGCTCTTCGGTGACCGGCGGTGTCACGACGACAC
TCGAGGGCTCGGAGTTGCCACTGGTGGCTAATAAAGAGCTGGTAGTTCGACGAATCAAGTCTAATGGTCGTCGGTTGAAGAAAATGTGGGCTATAGAGGA
TGATTTCTTTCCGATTGGCGCGCTGTTGCTGTCAGTGGGCTGCTGGATCTGTTCCCATTTCTGTGAAGCTGTAGCTGAGCCGGAGCTGGGCGGCGCTGGT
GTGAGCGCCGGCAACAGGCGCTGCGCTCGCCGAGCCGGACGCGCCGAGCGAGAGGCGTCCATTTTGTTGTACAGGGATGTCGAGTGGAATATTCGGCCTC
CGCTAAATCGGGAAATGACGTTCTTTTCTTTTAGCGACACGCTACGTGACCTTCTTCAAGTCACACGGCGCCAGTTTGGAAATCAATGTTGGGAGCCACA
GGATTTGCATATGCTGCCAGCACGCGAGTTGTCCCAGTCGACAAAATTTGACA