Description :
From Genome Similarity Track
Location :
Scaffold_59:42057- 46049
Sequence
3992 bases(100 bases per row)
GTTGGACAGCAAGGGTTCGGAGTGACTTGGCAGATGCAAAAAAAACAGTGCGGCTGCTTTGTATTGCCTCTCACCGGCTACAATGCGATGAAAACATCTT
AGCTGATGCTGTGAGGTCATTCGGAGATATCTATACGGGTTTTGTGGCTAGTGTACACTCCTCCGATATGGCTGATTGTGTGAAAGAAAGGTGGGCTTCT
TGTGAACAGCCGCTCTTTGTATTGGGATATTTCCTTCACCATTCTTGCGTGAAAGAATCGCGAAGCCTTCCACCAACTAATATAACCCGAGGGGACGCTA
TCTGCGAGGTTGCGATGTATTACTACCACCGCTTTGTCGACGGCGATGTGACGGGGTTGAGAGGTGAGATGTCAGCTTGGAAGATTGGCCAGTATGATTA
CGTAATAGCGGCAGATTTTAGTGGCACTGTGATAAAGTACTGGGAGTATTTAAAAAGATAAGCCTCATCCGATAATCTGCCATCACTTGCGCTGACTATT
TTGTCGATTGCCGTGGTCACATTCACATGTGAGCGATTGCTAAGTGAGCTTGAGCTGATCCACCTCCCCGCAGAAACCAGATGCGCGTTTGTAAGGCACC
GAAACAGCAGCTTGTCCGGCGGGATGCTCGGAATCACTACCGTAAGGAGAAGGAAAATACTTGCGCAGCTAGAGATGTGGAAAGAGCACTGCGTCCCCTG
ATCCCGCCGAGCTCGTTCGTACTTCATATACCGCTAGAGATGGCATAATAAATCTCAATGACACGCAACGGGCAGCATCCAGTGCTCAAGTGGATGTGGT
GCCAACGCGCTTACCTGTCAATCACTCAGCTCAACTTGATTCCACGCTCGGACGGTGGTCATGAACACCTTCACTACACCTCGACATGGAGCAACGGCTA
TTACTGAGCGTACAGGAAACCGCGGCTTGAGACGACGCTCTGTATTTCCGATCGGGAGTGGTCACGATGGCAGTATTGCTGTCTGAAGCACCAGCAATCA
GACAACTTCACATGCGAGATATCAGCTGTGTTGTTAGCTGGAAATCTTTTCGTTCTGCAATGATAGCCCCTGCCGCAGGCATTGCCAGTGCTTCAGTTGT
CGTCAGACCGTCAATCTTCGTCGAACCAAACAGCAGTACTGGCGACGCCTTTTGTTTTGCAGGACCTTAATGACTTGTTTGCTGCAGCCCAAGATGCGTT
TGACGCTGAAAGTGTCGATTTGTGTGAAGAAGGAGACGATATGGGCGGAGACGAAGGTTGCATCAGTGCTTGGGTTAATGTAATCCCGGATTTACCAGTA
ACCGGTGATGCGCAAGCCTCCACAGACTCACCAGGCAAACAAAACCTCGGCACGTTCGAAGATGCCATCGCTTTATTTGATTGCACTGAAGTGCCGTCGG
TGAACATGCCAAACAATCCCGAAGAAAGCACGCTGAACGAAATGAGAGCGCGTAGGGAGAAATTGCACATAATGCTCGCCAGGCGTCGAGATAGATATTA
AGCACACTTGTTATGTTGGCTTCCGTCCATTCAACGATACACACGGTTGGTTTGTGATGAAACAATGTGTTGCCAATTTTAGCCAGTCGACATTTTTCTC
GATTGAGATAATCTTACTTTACATGTACTGCATTGAAGGAATACAACACAGCAGCAGTGTAGCTAGACCAAACATCTGAAAGAAAATTAATGCGTCCACC
TAAAATTCGCTACATTAACTCCATTTCCTTACGTTGTAGACCCAGCGTATTCATCGAGGACGTCTCGCCCAAAGACTTGCCACCGTGGAATCGCTCTACC
ACACTTGGGCCTCAACCTCTGAAATAGCGCAATAGCTGACGGGAGTTCTACAAAGGAATCGGGAAGTAGCGCATTTGCTTGGAGCTCTAAGAAAAGTCTC
CAAAAGGTTTGCTGTTCTGTCGAAGTAAATGTCGTCTGAAGTCTCTGTTTCTTGTTGAAAGGAGATGGGTTTTTCGCCAGGACGCTTTGAATCTGCAAAT
CCATCGTCTTAGTATACGCATTGTTTCAACAATTCTCCCATTAGTCACGCCGACCGCGGCTTAACTCGGGTTCTGGCCCATGGTGATCGATGTGGTGTTG
CTGACAGCGGTTACATTCAGTCCAGTAAAACACAGAATTTAATTTGCCTGCGCAGCGTGTTAAAAGCGCGCTGGTTTCACTTGGGGGTCGACCCAGGTTT
GCTGAAGGACGGACGACAATCATGAAATATGGCGAACGGAGTGTGTAGTCCGAGGAAAACTGACAAATGACTACATTGGACCGCTCGACGTGTGGCTCCC
CGAGTAGTGAAATGCTACAGTGAAAAGTTTGTGTAGCATTGAAGTTCTACCAGGTCCATTAATACAATGCTTACGTAAAACAATGTAGAAATGTAATATT
CGGCATTGTTAACAGACTTTTATTTTTATTGTAAAAGTGTTTTAACCAGACCTACCAACAATGCTGCTTGTTACTACATCGGAAGGAAAATCGTACTTCT
AATTATCGACCTTTCTTTGCCGATTCAAGCGTGCCCTACGCTTTTTATTTCGTCTAATCACTTTTTACCTTTTCATTTCCGATACAGTTGCTCTTACATA
ATACATGTATAGCGCCTTTCTGAAAATACCCTCCGATACATGTCCCTACGTAGGACCTTCGCTTTTACGCGGGGGTTCATAAACCTGTCTTGGAACCATG
CAAAGCTCAGTGAATCTCCAACGTTAGTGCAAAAGACGAAAGTGATAGGATAAATGAAAACTGCTATCAGATTTATAAATAACACAATTACACGTGTAAT
AACTCTGCTTTTCCAACGGTACCCAAATAGTGGTTTAGTGCACGCGGCGAAAGCAGTCCCCTACGGGCAGCAAAAATCGTGTTTCCCGATGAGTAGCACT
CTCCAATATATTAAGGGCTCCTGAGGGGTGGACACTCATTGAGTATCCGTTGAGGCAGCACTGGGCGATTCAACGCGCAGCGATAATGCGACAAATCCCA
ATCGTGAAATGACTAGCCTATATAAGTGCCTCTGCGCTCACGTGGGGTGATATACTTCTCTAGACCACTTCAAAACGACGATTGGGCTTTTCAAGGATCG
CACATCGACAATAAACTAGTTCCATTGGATATAATCATCCATGATGACACCTGCCGCAGAAAACAATTTATTAGCCTAGCTCAAGTCAATCTGACCCGCC
CATCCTCCTAGGTCAAGTCAGCATCGGTATATGAGCCCAACATGACGCCAAAGCCAGCATTAATTCGACGAAATTACACTTGACAACCTTCGCCTTAAGT
AATTGAGAAAAAATATCTCTACCATCGATATTCTTCGGCTGATTAATTTGCTTGTTTATTCGTAATCTTGAGGTTAATTTTTATGTGTCAGTTGATTGGC
CAGCTCGAGCTGGTTGCTTTTGCTAATGCATCGGCTTTTGGAGATTAACCTCGCTCTCGTTGCGCCAAAATTGTAGCCCTCTTAGCCCGCTTTTATGTTT
GTTAGTGCGTGTAACGGAAGGCAACTGTCTGATCTACCCGCCCTTATAATGGGGTGTAATATCGCTAAATATTGACTGAACAGCGACAAAACCCCTAATC
GCACTCAAAATGCTGAGGATTTAGTGCTCACGCGTATCTAGCGTTCAAACAGCGAAACATATGTTCATGTGCGCTATGCCGAGAGCGTTATTGTGGTGCG
CTTTGTGTCTGCACTTGAACTCTGGTTGCAGAGATATCGGTAAAATATAAAATCGTCATTTTGGATTGGACCAGTGCAGTATTTAATGTAAATGTTTGGT
GAGGCTACATAAAGCGATTTTGGGGGCTGTGACCTACGAGAACTATTCTTTTGGCTGCACTACTGGAGGCACGTAGTGTATAATCGACCTCTATGCACTA
CGACTCTCCCTAGTGCACAATCGCTTTTGCAGCGCTACGTTAGCGCTCCCTTTTCGCCCATATCACAACACCATTGAATAACAACAAAATAC