Description :
From Genome Similarity Track
Location :
Scaffold_22:42051- 43366
Transcript NameFunction/comments
Phyca_LT1534566605Hypothetical protein

Sequence
1315 bases(100 bases per row)
tggagctgctccaaggtggtctcgtcgcactgagctgcgatgatccgcacgatgatcgtgtcgttggtgatattgacaatcgatcgaagccgatccataa
tccagtctgtactgacgagaatcgtgaacacgaccggtacgtccacgccgaaaactgtccgccacacagtgagaaccatcaccaaaccagcgtggggaac
gccagcaactccgaacgaggcgatagcactcacaaaagccagcagaatgaagcgcagcggggtcagcaaagcgtcgtagccgccgaccttagccagaaag
acacaggccagtggcatatacacggctgtgccgttcaggttgctcgtagcgccaaggggaagcataaaccgcgaaacctggtacgacacttcctttgtgg
cgtctacacagcgcatagtcatcggcagcgtcgcgattgaagaagaacagccgaagatgaagatctgggcagggatcatgtgccacaagtgcgagaaaat
attctttcttgtcgtcacgaacagcgccaaaccgcccactccaatggtaagagtaagcaaagccacgatcagcgtgccgaccaggaaagccacacctaca
accaactctgttgatgagctgtagctagcgattgaaccggcgatcaacgagatgactgcgatggggatgtacttgaccacgatattcacgagcaggagga
tgactgtattcgcctgcatcactaagaggagcgggtaattctccaagcctgcttccctgtccacacttttcatgagagcaatgcccataaccaccgcgaa
ggcgatgacactcaaggttgaggtgcctgcgaaggactcgaagatgttgttcggaatgaggtccttgaggatgatgaaaatctgctccgacacgtttaaa
ttctcgtacttggtgtccgacgtcagcaagtagccgctcacatcgtccagcacaaacaaactggagggtagagtgccgttgaccgagctgcaggcaagtg
atccgttagcgtacgagaggtaccggccgtcatcacactggaaactcagggaagcaattgttggcttgatgggcaccactgcacttgacggataaagctt
ggacatgacaaaagcgaagagcgttccaatgaccgacgacgtgatggaggccatggcgaaggacaggataattcgtctgccaatggacgcagccttgcca
gcctccaccagttccccaatacacacgatgacgctgcagaagaccattggagtaactaaacacttgagcgcagaaatgaagaggactccaggcagagcaa
tccaatcggcccacg