Description :
From Genome Similarity Track
Location :
Scaffold_1111:4205- 8032
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1111-snap-gene-0.4EF hand family protein
Pytiw_DAOMBR242034snap-piw_contig_1111-abinit-gene-0.14Histone acetyltransferase

Sequence
3827 bases(100 bases per row)
ACCAACAGCGACGATGGTGCGAACCTCGTGAACACGAACCTCGATGAGCTCAAATGGTTTGAACACCGCTGGCTCGACAAGCACGGTAAGAACAGCCAGC
TGAAGGAGTTGCGCGAGAAGATGACGCTCATGCGCCGCTGGTTCGAGTCGCTGGACGCGGACGGCTCCGGTGAAGTTGGGCTCGACGAGCTGGAGGATCC
GCTCGTGTCGGTCGGGCTCGCGCGCAGTCGTGACGATGTCCAGAAGCTCATCGACGAGGTCGACAAGGACGGCAAAGGTGAGGTCACGTTCGACCAATTT
CTGCACCTGATGTATCCGAAGAAAGCAAAGCGCTCTCGCCAGCGAGCACCACTGCACCAGCCCAAAGCGCGCGCTCAAGTCGAGGATTTAGCGGTTGATC
CTCACCACCAAGCGACTTCGTTCACCAATAGTAGCCCCGCCAAAGTGGACGCTACGCGGCCGTCAAGCCCACTCGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCACATGGCGCCACTATGAGTCCGCGGAGGAGAAGAGAGAG
CTCGAGGCACATCGGATGTACTCGCGGCGAGAGCCCGCAGCCCAAGGTAAATCCGGTCGTGAAGCTCTTTGAAGATCTGCAATCGGGGAAACTGGGCGAC
CTCGCGATCCCGTTCCCAGTGCTCATCACTGCGTATCGGCGCCGAATGCTCTTGAATGCCCACATGGCGGACGACCCCAGTGCTCGCAGGTAAGATTTCT
TGATTGACATGCATCGTGAATTCCAATGTCTTAATCGCCCATGTCGTTCGTTGTTCATCGATAGCTTGGGCTCATCAGTCCTCCAGGCACTCGAGTCCTC
TCGACGCGAAGTGGTGTCTCAGTCGGACCACCAGCAGCAGCGTTCCGACCCAAACATCGCGGCTGCAGCCCACGCATTCCTTCATCGTCGCTCGTCTTCT
TCATCCAGAGCAGCCACTTCAGCTGGATCAGCAAAGATCGAACAGCCACATGGCATTCTGAGCCGAAAGCAGAGCATCCTCAAACAGCAGTCGAGCGACC
AGGCAACACGGAGCAGACCTCCTTCGCCATCTCAGCTTCCAACCTTGGACTGACCAGCCGATCTGCTGAACATTCAAGTTGAAACAGTCAGCAAGTGATG
AACCGTCGAGCTTCCAAGCCAAGACGTACTTGCTCACGCCCTTGACATGTTGGGGGAATACGTACCTCACATTGCGGATACACACCTGGACATTCTTTTG
GTCTTGAGACTGGAGAGCAACATCATTCAAATTAACATCACTATTCCGCAACCATCCATCCTTCTCGCCTCTCAGCAACTAATAATATCAAACTAACTCA
CCACGAGACTCGTCAAAATGCCACCGCGCGTGCTTCTTCCACCTTGGAGCGATAGTGGCTGGGCGACTGACTGAAGAGCAGCTTCTTTCAGGCGCATCCG
GAGTCCATTCTCCATCGTTGCTGCCCACGTTCGCTGACTTTACCTCGGACGATCTTGGATACCAGGTTCTCAAAACTCGACTTCCCCCATGGAGCGGGCG
GTAACATTGGTCCGCTGTACACAAGATTTCGTTTCTTGATCAGAATTACCTTCGACTATTTTGCATTGACTGTACTCATTGGTGGAGTCTTTGATGAACC
ACTGGTACCCTGCGCTGGCTTCTGCATGGCGTTCTGTGTCGGCTGCGGTGATTGCGAATTTGTCCCACGGTTGTTGGTTGCTACACTGGCACCTGCTGGA
CCGCTCGCTTTCATTTGCTTGAATGCGGCCGCGTTCGCTGCTGCAGCCATTTGCTGCTGCGACTGAGAGAGCGTGCGCTTAAGACCTCTACCCGCACCGG
AGGATTCCGCAGGAGTATTCTTCGTGGTGTCACCTGCGCTTGAGTTCCCGCCTCCAAGCGAGGCCGCGTCGACAGAGAGATCAGAATCTCCCAGCAAAGA
CTGCGACAGATCCAGGTTCAAGAAGTCGGCGGACTCGGCTCCGAGGCCTCCTCCCATACCCAAATCCGCACTCAAACGACCGTTCATCGATGCTCGTTGC
TGAAGCTGGGCGTTCTGTGCTTGAGCTTGCTGCTGTTGCAAGAAGTTTGGGTTCTGACCTCGCTGATTCATCTGCTGCTGTTGCTGCTGCTTCGAAGGGT
CCATGGGGTATCCGGGGTTCACACCTGGCTGCTGCATTTGCTGTTGCTGACGCATGTTGTTCTGACGCTGCATCACTTGGTTTTGCTGGAACTGTTGCTG
CTGTTGCTGCTGGAGAGTTGTCTGGCGTTGCATCTGAGCTTGCTGCTGAGCTTGCTGCATTTGGAACTGCCGCCGTTGCAATTGGACAGCCTGGAACTGC
TGCATTTGCTGGGGGGTGAACTGCTGCATCTGCTGCGGGGTGAACTGGCGCATCTGCGGGTTTTGCATCTGCATTTGGAGATGTTGCTGCTGCAAAATCT
GCTGCTGAGTCATGCGACCACCGACGTTGGCGTACTGCATGTTCGCTGCGACATGTCCTTGTGGGGCCATTCCGGTTCCGATGGCAGCAGGGTTCACCCC
CATTCCGTTCTGCATAGCATTTCCAGCCATCACGCCAGTCCCATTTGGCATAACCCCGGCAGGTCTTGGATTTCCTCCTGCTTTGTGCTGCGCGCGGGCT
CCCATTGTCACAGCCAAATGCTGAAGTCGTGTCTTTAACGATGAGAAGTCACCGTACTCGTCACGATTTTTTGCCGTTCGATACAGTGAATCTTCAAGAC
GTCTCGCCATGTCCGGAAGTCGACGAATCCACTCGGCAGGAGCATCAGGTTTGCGCTGCTGAAGAAGACTGACACTGTATTTCAAAAGCGCACACAAGAG
GTATACAGTTGTAAGACACAATATCATACTATCATACAGCACATGATCCGCAACTTACATTTTTCCGATCATCTTCCGTCGGAGCGGGAGGTCGTTTTCA
GACTGCCATGCAGCTTGGCTGTCAGGGCTGCCAGTTGAAGATCCACCAGGAGTGCGAGCACCTTGAGACATCTGGCGCTGCTGTTGTTGCTGCGGCTGCT
GCGGTTGTTGCCCAAGTTGCATCGCTCGCATACGGTTGGCATCCATACCTGGCTGCTGGACTTGCGGTGGCATCATCATACCTGGGTTCGGAGCGCCGTA
CTGAGGGTACCCCGGGGTACCCGCTCGATTCATCACCTGCCCTGTACGTTGCATGTAGTTCGCCCCTCCCATCATTCCTTGGTGCGGTGCGCTCTGGCTC
ATGGAGATCCGCAGCACTTCCATCGGTGGAGGAATGAGGTCAGGATGCTGCATCATCATCGCCTTCACTCGCATAAACTCTTCGTCATAGCTGGAAGTTG
GAGCTCGGTACTGCGGCTGCATGTACTGGCCGTTCACTGGTGCTTGCTGCGGTCCACCAATGACAGGGTTTCCTTGAGCATTCATCTGGTATCCTTGGTT
GGCAAAGTTCGGCTGTCCAGGCTGTGTGCCCTGGTTCATCATCATCGGATTGGAATACCGTTGCTGCATCATGGCTTGCTGTTGGTGCTGCTGTTGTTGC
TGCTGATGCTGTGCAGCTGTTCCACCACTACGGCCAGACGGAGATGGGGCTGCGGAACCGGACATTGACGGACCATCGATGTGCGGCCTTGCCGACGATA
CGTTCGTTGATGCGGGAGGCGCGGACG