Description :
From Genome Similarity Track
Location :
contig_1:420496- 422165
Transcript NameFunction/comments
g123.t1hypothetical protein

Sequence
1669 bases(100 bases per row)
GCACTTAGCGGGATCCCGCTAAGTGCGAGGTCCAATGCGACACTATTTTGACGAATGAGAAAATCTCGTTTTCTGCCACTAGAAAACGCTCAAACTTTCT
GTGTCGTCGGTGATTGGCCGTTAAAGAAAAGCTACTGGCTGCCCACACTGAACGTGTCTCGCGCAGCCATTTCGCTGCTGTACCGCGCAGTTCAACTGTC
CTGCAGCAAGCCCGAGCAAGACCTCTGTGTTGCTCACCAAGCAGCAAACGACGACGACGATATCGGAGACCGAGCTGCCACCTGTGAGCACCGACGCTGC
CGCCGCGGTTCAGCGCCGCCACCTCGACAGTCAAGGCCAGCCATGCTTTCAGCTCTGACATCGTTTCGCACGCTTGGTGGATCCTGGCAAGGATTCAGCG
ACTGAAAAGCATGCGACGATTCATATGACTATTTTCGTTCTTGCTTACCACATGCGGCGACAACAGCTTCACCCTGAACTCTCGTTCTCGTCGACCTCCA
ACACGAAGATCGCGTCCGACAGTACATAGTAAGGCTGCTGCAAGTCCCCGCGACACAGGTAAGGAACGCGGCTGAAGTGGCGGAGCTTGAAGCCCGCCGG
TAGCAGCACGTTGCGCAGCAGCAGACTGGCTGCAACTCGAAGGTCGAGCCCTCCGAGCACAGCCCACCTCGCATCGGCAGCTTCTCGCTGGGCGCAACAC
GCTGCGTGCCCACCTCCACGAACGCCGAGAACGGCAGCACCACTGCCAGCAAGAAGAGTCCATTATTCGGGTCCAGCATCTCGCGGATCTCACGGAGCAT
CGTCAGCGGCTTGTCGGCACGATCGAGCACATTCAACATGCTGCAGCATTACCACAGATTCGATCGGTCAGATTAGTCGTGACGAACAAACCACGGCATC
GTAACGTCGCGCCCGGTCAAGAAAAAGGGTCGCATCGAGGCGAGGTGAGGCGATCCCGCGACGACGCACCTGATAATGTTGTAAGGCTTTCGCGACTGCA
CGAACTCGTGCTGCAGGTCGCAGGTTTGCACGCTGTTGTAGCCTCGAGCGTTCAGGTTGGCCACCATGGGAGCCGACGCCTCTGTCGTCGTCACTTCTGC
CACGAGCGAGGCTAGCGACGCTGTCACGTTTCCGTCTCCAGCCCCAATATCAAGCAGCGATCCGCCACCTCCCGCCACGGGCTGGTCGCGATGCAGGAGC
CGCTGCACCTGAGCTTTCGAAAGCACGAACATCTGACCACCTGCAGTGGGTAACAATGAGCGAAGGAAGATCGTGAGCCAGGAGTCTTCCAGTGCGATGC
TGCCATGGGGCACCACGTGGCATCCTGCCATCCTTACGTACGGCCAAGAATCCCGTTCGCGTCGGTCAGCGAGTAAAAGAGCCCCAATACCGTGGATCCC
AGGGACTCCCACAGACTCCCCCCTGTACAGGACTGTCCACACAACCATTATTGCTTTGCATAGTCATGGGGAGCCAATAGCACGCCCATACGTACATCTA
GGAACGTTTCGGTCTCCTCATCGCAATCCAACTGCACGAATGCCGACTGCAGCGCCGAGTCTCTGCGGGACGAGCACAGTGAGCACAGCAAGAATACAGC
AAGAATACACACACTGCAAGGAGGCTTACAGCAGCGTCTTGTCCACTCCGTAGTCCAGGGACGGCCCGA