Description :
From Genome Similarity Track
Location :
contig_32:420467- 422159
Transcript NameFunction/comments
g7359.t1XP_009520923.1 papain-like cysteine protease C1 [Phytophthora sojae

Sequence
1692 bases(100 bases per row)
CACCACAACATACAACATCCTGAGTGCCTAAAACGTCGGGTACGACATGTCGCCGTACATGCCACAAGTGCCCGTGCTGTCACTCGATCGCTCTAGTCGA
ATGTAGCCCGACTCGCCCCAGTCCTCGCCCCACGAGTTGCGGATCTTCCACTCGCTGTCCGTGTAGCCCACGACCACGACGGCGTGATCGAGGTCGCTAG
TGTCGCACGACGAAATCACGCCGCCCGTGTACTGCTTCCACGCGTTGTTGCCCGACGCCACAGCCACGATCACGGGCTGCTGGGCGACCACAGTGGCAAG
GTCCGACGCGCCATCCACCGACTCGTATCCGGTGATACCCGTGTCGACAGCCGAGCAACTGGTCGTGCACGAGGCGGCCGTGCCGTCCGAGGACGTGTAC
GGGTAGTCGTCCTCCGTGCAGAGGCCGTTTTGCTGGACGTACTCCATGGCGTAGACCGGAGCTCCGCCAGAGCATCCGTAGTTCTGGGTATCGCAGCTCG
TGAGCTGCTGCTCCGAGTACTTGTTGAGAGACGATTGCCCGCCCTTGATGCACTGCCCCGACTCGATGGCAGCCGCCGTCGAGAACGCCCAGCAGTCACC
GCACGAGCCCTGACTCTGGATGGGGGACATGCACTTCGAGTCCGTCCAGTCCACCTCGTCCGAGCTTGACGTGTCTGTAGCAGTCACCGTCGAGGTGGAA
GCAGAAGACTTGGTAGGCGAAGTCGTAGCCGGCGTAGCAGTGGTAGGTGTTGGGGTGGTCGTAGGTGCCGCAGTGGTCGGAGCCGATGTGGTTGGCGCCG
AAGTAGTGGGCGTCTGCGTAATTGGCGCGCTGGTCGTGGTTGAGCTCGAGTCGGAGCCGGCAGGCTTGACGGTCTCAGGCTTGAAGTCGTTCTTCCCCAT
GCCGCCGAAGTTGAAGCCGTTGCCCCACTGCCAGGGAGATGTGAAGCCCGAGCCGAAGCCGAAGTTCGACGCCGTGTTAGCGCCTGACGATGCCGTGTTT
GCACCGGTCCCCGACGAAGTGGTCACTGTTGTGCTCTCGGTTCCTGGGCCCGAAGACGTGGTAGTGCTCGTGGTTGTGCTGCTTTTGCCGTCCGCACCTG
TGGTGGTGACAGTCTTGACGCTAGTCGTCGAATAAGTTGCGTCTCCGCTCGAAGTGCCGCCCAAGACTGAGGTCTGTGCACTGCTCGGGGCGCCGCTGCT
GGTACTTGTGGTGGTCGTCTTGGAGGTGGCACCGCTGCTCGGAGATCCACTGCTATATGACGTCTTGGTGCTGCTGCTCCTGTGCCAGCTACGCAGTCGG
CGGTTTGTGGAGCTACTGCCGACCGACGATCCGTTGAAGGCGCGGTAGGCCTTGCCCACGTAGGCGGCGAACTCGTCGTTCGTGAGCAGAGTGAACGGCG
TGTTGGTGGAGAAGTTGGCGTTCGGGTTGAGCGCCTGGATGGCGGAGATGTTCTGCTTGGTCATGAAGAACCGCTGCAGGTGGTCCTCCTCCTCGTCATC
GGAGCTGCGTTCCTCCGAGTTGCTGCTCGAGGGCGGCATCCAGCCGTTCTTCTTGGCCTTGTCGCCGAAGTTGGCCTTCCAGTCGTCGAGCTCCTGTCTG
GTCTCGTTCCGCTCGCTCAGGTAGCGGTGGTAGTCGATTCCGGCGTGCATTTGACGCCCGTGCACGCCGGACACAGCCACCGCCGCAATGGC