Description :
From Genome Similarity Track
Location :
scaffold_85:42032- 44306
Transcript NameFunction/comments
g3115.t1hypothetical protein
g3116.t1 hypothetical protein PHYSODRAFT_263989

Sequence
2274 bases(100 bases per row)
AACAGAATGCAATATCAAAGATCCAGCTTGTTGTAGACCTAAGCGATGTCCTGCGTCCTGTGCTGCAGCTTGTTGTACGTCTGTATCAATGAGAATGGAG
GCTTCCCTTGTGGGCATGATATTGGCCGGATTAGTGAATACGCTGGCCCCCGTCATGGGGAACAGGTCGCTAATAGAGTCCAGACGGCGGCGGTTGTCCC
TTTCCCCACCACCTTCGCTTCGGGCGCCTTCTCCATCGCTCCTGGCCGTCGGTGTCGGCGGGTACAGACGACGCAAAGAGTGTAAAGACTGAGGAGCACG
GTACGGCACTGGTCGCGTGCGCAGACGCCCGCCGTCGCTGTGTGTACTGCGTAGTAAACCGGGCGACAGCTGGTCATCGCTCTCCAGCAACACGAAGCTC
GAGCGCGGCGACGCGGCCGCTTCGTCGCCGTGGAGTCCGGGAGACGGCATGCAGCGTAGAGCTCTATAGTAAAAAAGAGAATTTGGAGTCTGCCTTGCTG
GTCAAAAGTTTTGTGTAGAGGACTATTTTTTGCGAAAGGTGTACAGTAATCATTCGATAAATTGTTAGGATATAGGGAGAAAAGAAAATAGTGCGGACTT
TAGAGAAGGGAAGCTGAACCCTAAAAAAAGCGAGACAGTGGAATTGGCTTTTGGTCCATCACCACTTCAAACTGGTCATTCTTCACTCCACTTGACCACT
GTGGATTTTTCTTCTAAAAGCGAATAGCAAACACATGCACGCCGTAACCTCGCTAGGCACAAATGCATGTGAGTAAGGGAAAATATTCACTCAAATTATT
GCAAAAGTTTTGCAGCAAAACTACAGCTGAAGCACTGAAAAACATACACGAAGTCTCGGCCTTAGATAATCAAGGGTGAAATGCACGCGCCCTTTACTTG
TTGCTCTCCTGGTTGTGGTTGTCGATAGCCATGACGAGATATGCCGTAGCTGTCTTCAGGAACATGTTGAGATTGTCGTGCAGCTCTTGCGTCATAACCG
CCGGCACTGCGGGAGCGGGGGCAATAGGAATCGTTGGAAAAGCTGTGGCATCCATTGCTGCGTCGGGTTGCTCGGTAGTATCAAACGGAGGAGGCAGCGT
CTCCACGGTGGTTGCTTCTGGCAGCAGTTGCGAAAGAGCATTGGCCGATAGCGCTGCCTGAGCCGTAGCAACCGCCTGGACGGAGTCCGTGTTGAGCTTG
TTCTTGCTTTCCGACCGTTGCAACGCCCCCGTCACCAGAAACTCGTTCACACTTGCAGGCTCCACTCCTTCCGTAGCCTTGTCCCCTATGGTACAACCAG
ACATCAATGTTATGGCCTTTGAACGCTTTACCAGGCGCAATTAATCGTACCTGCGATCAGACTGGACACCTCAACGTGCGGAAACCCGCCCGTTTTCTTT
AGCCGCTGAAGCTGTAGCGAGAACTGTGGGCGGTCTTGAATAAGCTTGTCCCAGTCCTGTTCTGTTGTAGGCACCGTATCAAGATCGCCGTTGAAGTCTG
TCACGTGTTTGAACTGCTCGTAGGATTGCATCAGCTGCAGGTAGATGTCCTTGAATTGTTCTGTCAAATTTACAGGATTGGTATGAACAATCAGCAGTTT
ATCCAGGCTCTTCGCTTCTGTACAGGCACGTACGCTCATTAAAGTTGGTCTTGCAAAGTTGGTTGAGCTCCTTGGTCGCATCAAGCCACACCTGGTCACT
AGTGTTTTCCTCGCCAGATAGTTCCCAGACAACCTTCGCTCTCCAGCACAAAAACAATACGAGCTTCTCTTCCCGAGGGCCCCAGCTAAAAGTCTGTCCT
GGATCCACACGTGCCTTTTTGGAGTCTGGTGCTGCTCCAATCGGCTTACCACTACGCTTCACAGCCACCACCGTCGGGATTCGGACATGATGCGGCTGCT
TTACTTGTTTGACGTCCGCCACGGTGTCTCTCCCGATTGAAATACGACGGCAAATATCGACATGGGGAAAACCCGCCTCCTTGAACAGCAGCAGTCGTTT
AGCGCTGTCAGGGATCTCGACGATAAGTCTGTCCCAGTCCTTATCACTCAAGCCACGCTCCCCGCCCACGTCTTTAAACAGCTCGTAGTCCATCATGAGG
CGCGCATACTTGGATCTTAGCTGGTCTGTACGATAAAATACAAATGAATACCAGTTCTCATTGTAAATAGGTTACTTCAGAACGTACCAGTGTTAAAGGT
GCTCTTGCAACGGTCATTGACCTCTTCGGCGACTCTGTTCCATCCCCGAGCTCTCAGTCCTCGGTCAGTACGCA