Description :
From Genome Similarity Track
Location :
Scaffold_11:420315- 435398
Transcript NameFunction/comments
Phyra_75168Hypothetical protein

Sequence
15083 bases(100 bases per row)
GATTTTAGAAAAGGGGCAGACTCTGTACATCTCGTGAACTAGCGCAATAGGACTGCTTCAATGAACCTGAAGCATGCTGTATGAATTAGTAGCAGTTCTC
GCCTGTCGGCTCGCTTTATGGTCGGGTTTCCCGACCGCGTGCGGTCGAGTTGGTGCGGAGGTGGGCGCGGTTGGTGTCGTATCGGATTGGGTAGTGTATC
AGTGGCGTTGTGAAAGTGTAAGAGGAGTTTTGGGCGATATGCGGTGCTCCTCGTCTCGATGTGGGCAGAGGAGCACTGGTGTCGCAGAGGTTGAAGAGGG
GTCTATGGCGATGTGCGGTAGTCCCCGTGCTGGTGTTGGCGTTGCCGCATGGGATCATTGGCCCGGGAAGTTGCAGTGGCTGAGGCCAACACCGTTTTCG
GCGATGAGATCGGCCGCCAAGCCCCTTTGGTTCTCATCGCAGACAAGCTCGGCGAGAAGGAGCTTTGTGACAACATGCTGGACAAGCTGGAGGAGTGGCT
GACCCCGAAAATGGTTGGCCATGGCTGGTACAACGACCACGTACGTGTGGATATTTGTGTGGTAACTTTCTGACGGATTGGAGCTGTACACGTATGGACA
GACAAAGAGAAGGGTGTTATTTTTTTGAGTGGAAAACTATAAAATGGGTTGTGGATGCAGAAGGATTGTCGCGGTGAGGAATTGCGTTACTCAGTCGTTG
ATGACGCTATTTGCGTCTCCGACGTTGCTTGCTTGTTCGTGTGTTGCCGCTTTGGTGGTGGTGGTGGTGGAGGCGTAGACGGGAGGTTCCGCTTAAGGTT
GCTGGAATTGGCACTGGAGTTCGTGTGCGCCGCGGTGTCGGTAGCAGGTGCGCTGTTGGTTGAAGTAGGTGTCTTGTCGTTGCGGTTAGTGTGGATGTCT
TGGCGCGCATCAATTGATCTCGCGTTGCGTGCTTGCTCGGTGTCGGATAGATTCGTTGACGAGCACTCAAGTCTGTCTTCTGCGCATACACGTGCCACAC
ACGCTTGCGGCGTGTTTTCATACATGCTGAAGTTGAAAATGTGTCGGATTTTGTAGACAGTGCCTGTTATGATCAGCGGTCAGTGTTAGTGTTTTGCGTG
ACAAGTGTAGTGACGTACCGGGGACGAATAGTGCGAGGTCAATGTGCTCCCATACAGTCAAGCGGAAGGTCTCGCCGTTTGTTAGCTTGTGCGGACCTGA
TGAGATCAGCATGAAAATTGTCGCGAGTAGTGGCGCTCTCGTTTCGTGGTGAGAAGTGCCGTGTTATCAGTTCTGGATATGGTGCGGCACCGTCAACTTT
GTATAACTGACTGGCTGACGACGGACGTAGTAGAGTTCCACGGCCGTGAAACTAGCACGCTTGGATTTGAGGTGCAAGCCAATGAGACTGGAGCAGACGA
TCATGAGGCGTCGAGATGGCCAGACGGCATTGTGCGATTGAGCCGTTGCTTGAACCCAGCGAGGATTACATTTCGAGACGAGCTTGGGAATAGTGGACGC
TGTGTGTGCACGGGCACGTGCCTTCGTGGTGTGTGCGTCAATGCTGATGCGAGTATCTGTTGCGATGAAGGCAATTGTGGAGTGGGCGAGCTTTGCGGTA
ATCGGTGCGAAGAGCTCACGTGCGTGAAGCTTGGTGACACTTCGACGGGGCTTGGACTCGTTACGACGCTTCCACTGCCACCAGAGATTTGCATTGGTGA
GTACTGCGGAGTACTACGCAGTGGAAAAGCATTTACACGTAGCATGCGGCTTCGCGGATATGGCTTCGAGTTTGCTGAGGTGGATGTGAAAGGGAAGCGA
GTGATCGTTGACGCGACTTGGTACGGCAGTCTGTGCCGATTTATCAATCACTCTTGCATCCCAAATTGCCGGTTTGAGGTGATGATGAACGGTCCTGTGC
GCAAGATAGCTGTTATCACGATCGAGTGCGTGCCCGCCGAGGCTGAGTTGACCGTGCGGTACAGCAAACACGTGTGGTTCCATTGCCGATGTGAAGCGTG
CATCTGTGCTAGGCGGTTGGGGTGATCTCTCGCGTGTGATGGATTTATCGTGTTTAGTCGTTTGGGATAGCACGTGAATTTGGGTTTTGGAATGCTATGT
CACGGCTACATGAATTGGTTGGTTCGAGTTATTGTTTGTGTTGCAAGCTCGTGAAGACGTCGATCTTCCTCGAGCACGTCAGCTTTTGGGCAGAAAAAAT
TGAAGTCGGACTCGCCTGGTTTACGACCCAGCCAGTACAGACCGGCGCGGGTTCGGACGCGCGATAGCGATACATACAAGGCATGACGATCCACCGTGCG
GCAGTGCGGGGGCCGCAAATCTGTGACCACGATTTGGTTTCGCGTGTCGCCTTGCACCCCATGCACTGTGACACCAAAGGCTGGTACAACTGGGAAGCCC
TTAACGGAGATAGTGTCTTTTTGCAGCTTGAATGAGACTTTGGACTGGACAATTGGCATCACGGATGTTGGCCATTGCGTTGGGTTGCTGAGGAACTGCG
TGGGTGTTGGGTTGCTGTGGATGTCGACGTACAAGTTAGTTGGAGGCTCCGACGCGACCCACACGCCGTCTGGCTTTTGGTCGAATGTGGTTCCCGCATG
CCAGTCAATGTGGTAGAGGCTGGTGCCAGCTCCGTTCGCGACGCCCTTGGGTATGCATTGATTTGACTTTACGCGCACTGGCATGCCTGTTGTTTGCATC
GTATCCAAGTTAATCAGTGTTGCATTTTCTTGTAGACGAGAAGTGCAGTTACCAATGTAAGCTTTTAGAAAGACTGGAATGTTGCCGGTTTGACTGTCTG
CTAAGTCGGCGATCTGTGCAATTTTCGCAGGCGTTAGTGTCGCTGGTAGTTGTGCCGGCACAGCATACACTTTGCGTTCCGGGGCTAATGCACGGCAGGC
AATCTGGATTGCGGCGTCATTGATTCGTTTGCGGTACGCGTTGTCGGTCGAGACGACCTGGATAAACTGGCCATGCAGATCGTCAGCTGGTAGGGTTCGG
CCTTCCCGAGAAATTCGCGCAGCTCCGGCACCCAGTTACCTTCCCTCGCTTGTGCGAGCCATTCACCTCATTCCGGGTCACTCGCGAAGCGCATGTTTTG
CGTTAGGTAGACGACTTTGTTGACCGATCTGTACAGCAATGACCCCCGTGCCTGGATTTCGCTGTATGGCTTTTGTGAGTCTGCTACTCTGAAGGCCGGG
ATTCCACGTACTGTGAGTAACTGGAAGAAGTCAAACATGAATACTCCAAGCAGCCCGCCGAACGGCTGGCGGCAGTCTTTGACTTTCTGTAGCGCTTCTT
CCCAAAGGCCAAAAAAGCCGACGTCTGTCATTGACATCTCGTCGGCAACCACGCACAATACGGGATCCCATTTGGTGCGCAACTTATCACCCGGTTTTTG
GATGTGACGTGGCAGGCACTTTTGGTTGATACCGAGGTTAACGGCGCTGTGAATGGTATGCCCCTTCAGGTTTGCAGCTGCAATTCCGCTTGACGCCGTT
GCCATGATACATTTCGGCCGTCCCCAATTGCATGCGAGGCATCGCAATGCATCAACAATACGCGTTTTCCCGGTGCCTCCTGCTCCCGTTATTATTAATG
GATCACCACAGAAAGTCGACTGCGGCAGCATCTTGATGTCGGCGATTCTGTACAGGAGCGGCACCGCAACGTGCAAAAATGCGAGGTGTTGCTCTTTGTT
GAGGTTAAACGCGCTGGACACGCTCTGCACCGAAGCAAACGGCGTTAGGTTGTCGATTGACAAGGAGTTAGTTTCGGCGATCGTCAAGTCAGCGACGGCA
GCGTTGAGTAACTCCACGGTAATTTCGGTCGTCTGGACGAAGTCGTTGTTGTTGGTCGAGCTGCGTTCCGGCGGATGCTTGGCTGCTAGTTGTTGTTCGA
AGGTCTCCAACTCGCTCATTCTGACTGGTACTGAGCGCACGAATACGTCAGAAATCTGATCGGCTGGCAGATCAGTGAGCTCAACTTTGTTACTCAGCAG
TCTTTTCACGGCGCTCTCTTCGGCAGCGTTCTGCAATAAAGCTGCTTCTTCGTCCGTTATGTTGATCGGGTTGGTGACGGCAGTGTAGACGTCTGATCCA
ACTGCCAACAGATTTTCGCTTCGTGCAGCTGCAGCGCCACTGGCACGCTCAAAGTGACTATCTAGTACGTCGGGATCATCGCACGTACTGTCTTCACTAT
CTGTCGTCGGCTGTGCCCGAAACTCGCTAGCCTCATCGAGAGCGACGTAGTATTGCTGATGAAATTCAAGGGAACGTTCGAGCTTTGGGTGTGCATTTGG
GTTCCACCTCAAGAAGTGCGCACGCGCTGACCCGTTATTGTCGAGAAAGTCCTGTGGACGTCGGAACGGACAATACAGGAGTGCTGCTGCACGGCAGTAC
AGCTCTGCCTGGTCGCTGCGTTCAGCGTTTTCGAGAAGGCGAGCATCTGGTAAACGCGGCCCGATAATTTCCGGCACGCTAGGATACTCCACTCGAGTGA
GTCCATGCAAGCGTGAATGTACTGCGACCAAATGCGGATCGTTCGATGCAAACGTGCATGCCTCCCCCGAAATCGTGGCCTTTGATTTACTTGGCTTGAA
CCACGCGCAGAAATCATACCAGCAGCACTGCTCGAGACATCGCGGACGTGCGATGTAGTGTCGGATTGACGATTCGATCACAAAATCATTGTCCCGTCGA
ACGACGGATGACTCGATGTCCTTGTCAGCCATCGTTTGCAGACCTTCAACAAGTACGAGACGCTCAAACTTGCAACTGGATGTCCCGGCCCCACCTTTGA
GAAGTATGGCTGTCGCTAGAGGCCCTCCGATTTCGATCGTCGACGATGCCGAGTATGCTAGTGCCATGAGACGACCGATGCCTTGCTGTATCTCGATTCG
GTTCGTTGGTAGTGTGGTGGCCTCGCGCTCCTCGCGACGTCGCATTGCGAGTTCCATCACATTAATGTTGTCCAGCGTGCTCTGGCGCTTTGATGCATAC
TGCATGCGTATTGAATTGCTTGCAGGCTATTGCCGGACCAGAGAATTCGAGCACCCATGTTAAAATGCAACAGACGTCGCCAGATCGGTATATACGGGTT
GAGCCATTGGTTCCCAACACTGCGTCGGTACTTCATTTTGCCGTCATCAGTGAGTTGCGTCTTGTTTTCAAGATCGCGGAAAAAGTGGTACCTACACGCC
GTACCAGACGTGCCTTTCACACAAGAAGATGTGTGCTCGTACGCATGCACCTGGTCGTGTTGCAGAAGTCGGCTGAGCTGCGCGCTGGCGGTCGGCTCGT
GCGCCGAGAGCCCACCAAATCGCAATCGGAGCGTGCAAGCCGTGTTCTCTGTACTGACTGCTTTATGCTCTGCGTCGAGCTCGTTCCATTTGCGCTCGAT
GACCAGTGCAGCTACGTTTGCGTCAGTTAACTGCTGCTTGCACAAAATCGATGCGCAGTACGACTCGAAGCGTGCACGCATCGTAGAGTCGGCGAGTAGT
TTTTCCCAGTCAGTCTTGGTTTTCGGCAGGCCGGCAACCCACATCACCCCATGGATGTGCACGCGAAGGCGTCCTTGCTGTTCAAGTGCGTAGAAAAATG
CTTCGACAAATCCGAAGATTCCAGGCTCAAGTTTCGGTTTGCTTACGGTCGAGTCCCAGCCGAACATGATCTCAATGAGGATCTTGCAGCACATTTCAAA
GTACCGCGCCTGCAGCATTGTGTTCTGCATTGTGAGGCGCTTCATACTGGCGGTGCTTGGCAAATTAACGACTGTGCATGCCGCGAGATCCGTCGGACGC
TTGTATGGCAAATCGTACCCGGACCAGAATGCTACCGCAATGGACCCTTCCGAATACGGTGTTAACGTCCAGAAAACCGATGGCTTGCCATACATGAACG
TCATGGCATTCACCTTGCGCTGAAAGCTATCGCGCTCTTCATTCGAGCCCCACATCTTCGCCGTCGACGCATTGATGGCTTTGAGCACGCTGTTTGCACA
GTTGCGACCTTCGCAGGACGTCACTGGTTTTTCTGTTCGAGCAGCACGCCGCATTACAACGCGCGCTTCCATTGCACCCCGCAACTCCTCTGCAGAAACG
TGCATGGCACGCGTCGCGGTGTTTGGGTCGTGTCGAACGCGCACGAATACACCCTTCTTCACGCGCTCTGTTGCCAAGTAGTCGTACATTTGGATTTTGA
AGAGGGGGTCCTCCGCAAAGCGGTTGGATGAGACGTTCAAGTAGTGCAGTACCACATCACGCTTGCTATATCGATGACTTCGCGAGCTGGAAAATCCGCC
AATACCAAAAGTCAAGAGATGCGGGTATACGCGCTCCAAATAGTAAGGATCATTGTGCTGGAGAATCGATGTCGATCGGCGCGCAATATACGTTGGTCTG
CCCATGATCATGTCAACTGCGCGTGAAAGGCACGCCTCCTCGTCGTTATCAACCGCCGTCTCGACGACTACGGTCTCTGTTGGGAGTATACTCGTTTCGT
CGATATACTATCTGATGGTGCTGCTACGGTTTGCTGTCTCGCACGCGCACGTTCAACGAGTCGATTTGTGCCGTTACTGTCGTTGAGCCGCGTGCAGTAT
ACTTCGTGAGACTCGCCAACGCCATGAAACTCCGGGTTTTCGTTGACGTCCCTGTATAGTGGATTCATGCTGCGCAATAACACCTCCAAAGCATGCACAC
GTGCACCATCGCATTCGTGCTGCTTCGCGACGACTAGTTCTTGAGCAGTTGTCATCGGGCCAGCTAGCACCACACGAAAGTCATTCCGGGTGGGGACACT
TGGCACGCGACTCGCAATTGTTGCGTTGCGGTTATCCCACGACAACAAGTGGCTCTGCAAAACGTTACCGGGTCCTCCGTACACAACCGTCACGAGTCCG
CGTGTTCGCACCAGACCGACAGCTTGTCGTTCGATCAGTGTGGACCCATCAATTTCGCTGAATGTCCCTGCAACGAAACAATCCGCGATCGCGAACCGTG
GCGGTACTAACTCTGTTTCTTCGTATTCCTGAGCGAGTACATTTGCATTCATCTCTCTCAAATGCTTGAGTACTTTACGCGATCACACTCGGATGCAATC
TTCACTTTGATCGATTCCGCGTGGAGACAAAAGCATCCCTGCCAGTCTGTTGTCTATCGTGCCGCAATTGTAGTAGTCTCGGATTGGGGGCGTGGTCCAT
GGATTAGGTCCGAGAACTCGGCGCATTGCAGTGAGTGGTAGCTCTTCGACTGTAATTCTGCACGCATCGCGACGATAAACCCACACATCCGTCACAATGC
ATGCTCGTCGGTCGATAAACTGATCGCCGAACTCACGCACAACCTCCGCCTCAATCCGTTGACTTGTCGCCGCTGTCAGTGGCTTAAATTCACAGGCGGC
ATTAATTGCTTGCACTTGCTCGTACGATAGCCATGGTGAAGGTACGTGGGGAACTTTACACAGCACAAAGAGCAACATGACGTTAAAAAAATGTGTTTTG
CTTTCATTCATATCCAACACAATTTACCGTTTCGTGCCCCCGTCGACGACCGAGGCGAGCGCGCACGCTTCGTGCACCTTTCGCGCTGGCTTCTGTGGTG
CTCTTCTCTGTGTCGCTTCAGCGCTGCGAATTGCTGCTGGGTCGAATCTACGAGCTGTCGGTAGGGGACGGTTGCGGCGGCAGCAACTGATAAATCGTGC
TTCACCATAATGAACCTTCAGAATTCCAACACAACCTGTGCCTTTAAGCGTAGACGCTGCAGTGGTTTTCTCTGAGAGATGGCGCGCACACGTCGCAGTG
CTTTTCTCTGAGAGACGGCGCTGCGCTGAATATCCGGCTGGTTGGTAGAACAAACTCAACTTATTGGTAAGCATGGAGACATCACGAGAGCAAGCGCGTC
GCCGCCGGCACCGCACGGTCAGGGAGAAAATCGATATCCTTGGCGCAACACGAACCTGTTCACAGGTACGCCCTCCTCCCGTAAGGAATAAATCCATTCC
ACCAAAAACTGTTCACCTGCCGCAGAAATCGTTGTATCAGTGCCAACATTGCCGGCAACGCGTTGAGAGGCCGTACTACCGGTGGCACAAATTGATTGTA
TACAGCCGCCCTGGCTAATCCACTCATAAATTCGCTTGCGTTTATTTTCTTGCTTCTGCGGAATGAGACGGCCGTAAAATGTAGTCAACGTAGCTGGCAT
AATGAAACTCCATTACTTCGATCTTCTTGTCGTACGGATCCACTTCGCGCTTGTACTGATTTGGCTATCGGTCACACTCGCTTGCGTCCGCGTGTCATCA
CTCCACTTTGGCGCTGCTGTAGGAAGCCTTCTTGCAGTTCGCGCTGTTTGGGGAGTTATGTTATTGCTCTGCTGGCTCTACGGGAAGTCGTGCTGGTAAA
ATGTTGCATGTAAGCAACGCATGTGGTTAAAAATAAGTCCAGATTAACAAATGTTATATAGTAGCTACTAAAAGTTGCCTCAACACTAATGTGACAGATA
ATAATGTTCATGTGGTGTAGAAATGTGACCAAAACCAAATTAAAATGTAAGTATGCAGACTGGTGTACTGGTTTGCACACGCCTACTTAGCCAGACAGCT
AGCAGGCGGCGCGGGTTCAATCTCCATGTCTGTAGGGGGCTCGATGCTTGAGGTAAGTGTCGTGTGTAAATCCTCTGTCGTTTCCGAGTGTTTGGGTCGA
CGCGATCCACCCCTCTCGAGGGGTGAGTCTCATGTTGAACAGTCGGGAGAGCATTTCTGGGAGTATAACCCACCTGGAGGTTCTGTCCGATCGGCTATTG
GCGGATGACAGATGGGATCATTCGCTGGGCACAAACGCTCTCGATTGGCTAGAACCTTCACGTTATTGCATAACTTTGAGCCACAAAAATCAAGAAAGTT
TGACAAAAAGAAAACCATTCCATGAGATAATAAACAGATTTTAGCGACATCATTAAACATTTGGCTACGATCTCCCCCGTGCTGACATGGTATCCTGAAG
TTTAGGCAGCTCTTCCGCATATGTTGAGGCAATTCTCCAGACGTGCAACAAGACCTCTTATTTTGAGTTGCCAGGTCGGTACCACTCCCAGCAATTCTTA
CTTGCCGCCTAATAATCAAGAACGGCGAACCTCCTACTTCATGCCGAAAAAAGACCGACCCGATCGAGATTCCCTTTAAGGTCAGGCGCGGTTTTATAGT
GCTCAAGGCTCAAGTCTCGCCAGAATTTTATCAAAAGCTCCCGGACAAGCGACAAGATAATTCCGGCGTTTTCCACTAGCCTTCAAAGAATGACCCCCAA
CGATATTTTCTAGAGCTGGATGAGGAAATTACGATAGTCGAATTTCCAAGGCCTGAGGTCTCGCTTGTCTTCGCCTGCACGGTCAGTCTGACTTTATTAT
GATCTGTGTTCCGAGGGCACCAGATCCACTCACAAACCCGATTCGGAGGGCAACAGAGAATCGGACCCAAGAACAAGCTCCTCGCAGTGCAGCACTATTG
GCTGAGCGCAATATTAGAAGTGGACCAGCTTTGCAACTCTAAATGACGGCAATGTGAGATACACACCTACCAGTGTCCAGATACGCAGTCCACTTGCAGT
GATCAGACACTGCCAAGTCGCCCATCGCGAATGCTATCCTTTGCAACTTGACGTCACACGCGGCTTCCCGGCTCTTGAGAGCTCGACTGCGTGTGCATAT
TTGGGTAGCTGTATGCAGAGGACAATTGACGGCGGAGAGCACGCATGATGTGTTTCCCGCAAGCGCGACGACGTACATGTAGGACTTAGTTCTATTATAG
ACTCTAGTGCTAGTATAGACTGTATTGATGTTAGTATGCTGCGCTACTAATACATCAACCGCTGGTGCGCGGTGACTTGGCAAGGGGTTCCACACACTTG
AGAACTTGACACCTGCGGCGCAAGTGGAACCTCGCCTGCTGCCAAGACCACCGCTTCTGCCTGTTGTAGTATTCTGCCTCGGCACATACGTGTTACACGC
ATTGCCTCTATAGTTGCCCTAAGTATTATACGTAGCTCGCAGACTAAAAACTACGCTAATGACCGTAACGTTGCGAAGCCAAGGACGAGATGCTGGGGGC
ATGACGCTCAACGCGACTCAGGCAATGCAAGCGCAGCTTCTCGTTGATGTGCCGTTGCAAGTCCCGATAACGCAACTTTTCGCCAACTTCAAAACATCGA
CCAACTTTCCCAAGAGATGCAAACCAATAAGCAGTCCGATCAAGCAAATGTTGACTCAAACTTCAGTTTGACCAAGGCGATGGTCCAAGATTTCATTCTC
CAAGCAAATGTCCATGTTGGAGATCTGCGATAGGTACTTGGATTATCATCGTACATCCTACTACCTCCATTTCGTGATCCGGTGAATTTTGAGACACCAA
CTCCAGCCGAAGACGTGGAAGACGCTGACCACATTGACATTCCACAAGACAATGTGTGATGACTAGGAAGTTAGATAAGCCCCAATATATGACCTTCATT
GACAATCACTTATTTAATGCCAAATTTGTTTCTTTCGTATCCACTGCGTCCGTATAAATTTACTCCCACTTCTTCTTTTCGCCTAGTACAATAGTGCATC
GCGCCATCATAAACAGTCAGCGGATTTTCACGACAAACCATGTGGCGTGACGCTGGATTCTTCGCTTCAACACCGAAAATCAGACTTCAATCGGATTTAA
ACCCGGTGAGTATGGTGGCAAAAAAACAACAATAGCGCGCCATTACCGTGAAAAAGCTCTTGAAACTCCTTGTACATGTGAATTTCGGCGTTGTCTAAAA
CAACAATCGATCTCGGTAGAGCCCACGGGTTAAGATGTGGTACGATCCTCGATTTGAATGTTTCGTGAAAATTCATTTTGGTAAAAGTGTCCTTGGTTGT
ACCCCAAGCAAATAATCCTTGAACGTCGAAAGCGGCAATCACTGATACCCGCTTGCGTCTAGAAAATGATATGGGCACAATTGCAGGAGTTCTTCGTGCC
GACCATGCATATTTCCGAAACGATGATCCATAAATTAACGATATCACGATCAATTTAGTGCCGGTTTTAACGTTAACAAGCAAATGTAATTTTTCCCTTC
AGTCTTTGGACGTTTCATTGGCGATAACGAGTTGATCCGGGCCTCTGTAAAATGGTAATAGCCGGTTGATGTACTCCTGCCGCTCGTTTGGGATACTTTC
GCGAATACGTTTTGTCAGAACGATTCGTGAGAACCCTAATTCAAATCGTTGAGTCCGAGCAGCAACAGCTTGTCAAATCGTTTCTTTGTGTAGCGGGGCT
ACACAGTCGGTTCACCTCCTACCTTAGTGCAACACGCACTAATGTATACATTCAGGTTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAAAAGCA
TATGACTGGTAGAAAGTAACATATTTCTACCAATGAGAGTCATTCATTAGATAGGGGTTCTGCCAGCCATCCGATGGCAGAACCTCTCATTAGAAATATC
AGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCTCCAAAGCTATCGTTCGGTTCCTTTGACTTAGTTTGAGTATACTTGCAGATA
CAAGTATACTGAACTTAAGTAAATTACTCCTACCCTTCCTCATACACGTGCGCATACGTGTAAGCTTCAGTAGTGGGTCTAAGCAGACCCATTACACAAA
GTCAAGATATCCGACACGGGTGTCGTTGCCAGCAAGGTTTCCGCGAAATAGTATCTCGTGGTTTCTTCAGAGAAGCCGTCATGCTGCATCTATGAATTTC
ATGGCCTGCGTCCTTAGGTCGTTGACCCTTCCTGGGTGTTTGAGCTGGATTGGAACTATATGTACTACTGGCGCGCTGATGTGATCCTGTGCAAGATGGT
GATATGTATTGGATATCAAGGCTTATACCGTGGTGCATTCAACACCAACTGAAGGGAGCATTGTTCTACTATATGCAAGAATCTTTGCGGCCGTGTAAAG
ACCCAGAAGATTGTTTTCGGCTAAAACTATTTGATATGTAGACACAGCCACCCAGTTGACATCAAGGAAGAGGATAAAGCAACAGTGACGTCACAGCATA
TATTTTTCACTATGTAACCAACGGCTTACAAGCCTTTGGAGTTGTTTTACTGGAAGCGCTTCGTACGTTAGATCAGACGATTGTTCCTGTTGCCAGGCTG
GTGTCCGATAGTATGCGCAATTATCGCAGGGACAAGGGTTTCAAGTCCGTTCAAATCTTCGTTGGTCTGCGATGATGTCCAGTTCGTTCATTGCGATTCA
CAAGGCCTGCATATGCTTGAACTTGAGCTCGTAAAACAAACCTATAAATCGATGACCAGATAACCCTTTTTCGTCAACCGACGGGTCCGACTCCAATTCG
ATCCCACGCTCAATATGCGCATCGAGAAACTTTCCTTTTTTATCAGGAAGTCATTCAGAAATGTCAGACGATCGCGAATCATTTGCCGAGTTATCTAGCA
AAATCTTACGAATTGAGTAAGTACTGCGTTTGACGATGTCAACTACAACAACATTGACATTACCTCTCTTATCTCCATGGATTTCTGTAACCAATTCATC
ATCCACAGGAAGTCGTGCATACGATTCTTATCTCCTGAGCAGATACCTTTATACACCGCGTGCATCTCCTTGAGTGGCAACATATCGACGAAGTCGTCGA
TATACTCGGTAGATTCAAATGCTGTCTCGAACGCATGTATTCATAAGTCATTAGACAACGAACAGTTATAGGTCAAACGACAGCAAAAGTTGCATATTAC
TCGGGTATCCGCCGGCATAAACACGGGGAGCAGTGAGTCGAAGTTCGCTTTGTACGTGCTAGAATAGAAGATAAGAGCTGCTGAGAGCGATGACCTAACG
TAGATTCGTCTCCCATTCGATGCGCAATAACCTGTCACAAAAGAAAACTTCACCAATGCCCATCAAAATTTGTACGCAAGCATATCACACACCTACTTCA
ATCTTATCCAATCGGCGATCCATTGTTCGTTCCTGCACCCTCAGTAAATTATGTCTCTTGACGTTATTTGGTTAGTGACGAGGAGAGTTGTGGAATGGGT
GAACCTCTCGTCCAGGTCACTCCTGAATAGTCAGATCAGGACCGAATACTTTGCTTTTGTATGCTTGTCTATATTTTGGTGAATGCTGGGGTTCACTGCT
CCTCGCGAAGATTGGATATATAGACACACGTGGAGTGTTGATGGTTGATGGTCATCATCTGTGGCAGGTCAAGAGCAAACGCAAGATAAACTTATTCTAG
TCACACGTGAAAATGAGTACAACTAAAGGGAATAATGACCACATGTAATTGTATACTGTATTTATGATTATGGTTGAACTGTCGCTACTCAATGCCGTCG
AGCTCCAGCGCACGCGTAACAACTATTATTTATCATGGCGGTACATGAGCCCATGTACGTCGTACGAGATTGAACGTCGAGCCGATAGTGGCCACAGCAT
GCTCTCCACGTCGTCAACCGTCGTGTACACCGTGAACGTGAACTAGACCAGCACTCGTGGGGTCTAGCATAGTCTGCTCACGGCGACCACTGCAGCAATG
GGGTTCTTGTACAACTTGTCCGTAGACAGGTCGGCCCAACACTTACATGGGTTCGACATCGCGGTTGGCGTGGCTGTGAACAAGCTCATCGTGGAGATCA
GCGTTGAGGCTAGCACGGCTGTGGACTAGTCGGGCATGAACGTGGCGTAATGTGCTCAGACTAGCCCGGCCGTCAACTAGTCCGTGGTGTGCAGTTGATC
AGCTTCATCATTTTCATGTAGCTCGTCTACGGCAGAGACGGGATGAATAATTGATCGTCCCTTGGAGTAAATAGCATCAGAGCGTTGTGCATTGCTGGCT
TATCTCCACCATGAGCCCCCCCCCCCCCCAGTGATTGTGTGTAGCCCGCCTCGAGGTACTGCTCGTTCATCTTCTGTAGCTCTGCCGTCCTCAACCCCTC
GGTTTACTACTCTATGCGCTGCTCCATGCTCCACTCCGCCACTACAAGAGGCGAACGACGTGGCCTTGATTTCGCTCGAGTCTTGCAGGCGCTTGTGTTG
GGCAGACCTATTAATATAGAACTTTATGGCCGAACGATAGGGTTAATTTTGGTCGAATGACTATTAATAGGGGGAATCGAATATCTTGAATGAGCAACAA
CAAAAATGAGCGAAAACCAAGAGGAAATATGAGCGAGAAAGAGCCGACAACATAAGCCAAATCGCAAAGGGGGAGTCACATTTCGCTCATTCTAACATCG
CACTCAGCCGAGCAGAAGGTTTACGAAACCGCCAGTTCAGAAAATGCCGAAGCAGAGCGATCGCCAGCGTCTTCTGCTGGAGGTGGAGGATATCTTGGCA
GTCAACGCGCTCGAGGAGGAGGACGATGACATGCTGATGCTGAATGAGTATGATGAAGAAGCGGATCGGCTTCTATTCTCGGATACGAGTGAAGCCAATG
AATTACTCCAGCTTGTGCAGTCGTCTCGCTATCTAGTTGGTCGAGAGCGCGCGATAAAGAGCACTATCTTCGTCGCTGATGCCTTTTGGTACTACATACC
GGATCAGCGCTTTCGTGATATCACTCGAATGGACAGGGAGACTTTCGAGCGTGTTGTTGGCGAAATTGAGAACCATCGAGTGTTCCTGTAATGGGTCTGC
TTAGACCCACTACTTAAGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTA
AACTAAGTCAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGG
TTCTGCCATCGGATGGCTGGCAGAACCCCTATCTAATGAATGACTCTCATTGGTAGAAATATGTTACTTTCTACCAGTCATATGCTTTTTTGCTATTAAT
GTGGACCATCTTGTGGAGTGGTCAACCTGAATGTATGCATTAGTGCGTGTTGCACTAAGGTAGAAGGTGAACCGACTGTGTAG