Description :
From Genome Similarity Track
Location :
Scaffold_14:420247- 423032
Sequence
2785 bases(100 bases per row)
ACAGCCTTGAGCCTTGACACATGCACTACTGGGTAAAAGCGATACTCACTTCGATCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGAAAAG
GTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGG
AGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTCTTCGTTTCCACTTAGTTGAGATATAGCAGCTTTTTCCAGTCGACTC
AGAGCATCATTATGCTTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCC
GCCACGCCAGTGCGTCTGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAA
CGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTGATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCTGCGTAC
ACCCGTACGGACCCCATCACTGACTTCACCGAACGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTTAAAGTCGCTCTTGATCTTGACTGCATCATCT
CTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACGTTCTTCGAACAC
TTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTACGA
GATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACCAGGTGAGTATCCACGAAGCTGTGGACGGCTTT
TACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCGGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCAC
CACACCTTGATGTCCTCCTTGAACCGGTCAGCGTATTCCTAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGTACCTTCTTGA
TACTAAACCACTTCTGCTCCTCGTCTTGTGCCACCTGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCACCATCTTCCGCATCGGGAAATGC
CGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAG
ACATCCTCCGAGTGTTCATCTGCAAACCTGACTCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCAATAATCGCACTTTTGTTAA
GCTGTAATCAAACCACGAAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAAAC
ATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTTCTGGATGCGGTTCAGCGATGCCAATTCCCGACTTGCGAGTTTCAGCCAAGATTACTCGACTGAC
CTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCC
TTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAAT
CCTCGGCATCGTGCGCAATAGCAGCCTTGACACCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAAT
CACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAAT
CCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCT
TCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTTAGGTGCCACTGCGATAGCA
GCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAG
CTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAAC
CGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTAAACTTCTTTCGACCGATCGA
AGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTT
GAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCACAGGAAACGACTGCAT