Description :
From Genome Similarity Track
Location :
Scaffold_159:42017- 48027
Sequence
6010 bases(100 bases per row)
CTTTTTTCCCACCGCCTCCGTAGTTCCAGCTCCTTTCGGCCTTCACGTTCCGGCTGGCAAAGGGACTGGATGACGAGTCCCCCTCATGGTCTTGCACCAG
AGCTGCTGAGACTGCCCAGTTACTGCAATAAACTATTTCCCGTAGGTCGACGTTCCGGGATCGAAATGACGGAGGATAGGGCGTGGTCCGCGATCCTGTT
CTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCAAGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTT
GGTCTCAGAGTGGATCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTG
GATTTTCATCTGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGA
CTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCTA
ATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTC
CAGTAGGGATGTCACTCTTTCACACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCA
GGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGG
CGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATAT
TGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTG
ATCAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTA
CCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCAC
CTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGC
AGATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGACCCACTTGGATATCATCAATCGTGACCTCCTCTG
TGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTT
TGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCG
GTCGGATCTAGCCGGTCCTCTAACGAGTCTGAACCCGACGGTTCGGGTTTGACTAGCGTTGCCGCTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAA
AGCTTGGATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTG
GGGATCGTCCCCCGTCATGGATCCAACCTTCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCC
ACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGC
GGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCT
GACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACC
CACTTCAACCGGTCTGACAGCTCCCAATTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCC
GTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGAT
GGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCGTTTGTACGGTAT
ACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCAC
CACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACG
GGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTG
GTAGGCTCAAATCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAAACTTCGGATCTGGCAAACT
CATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGA
TGTCTTGTTCCCAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTT
CTGGCAACATCCCTCGGTGCTTGGCTGGATCAAATCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACA
CCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGG
GATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGT
TGTCTCCTGTATTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCC
TGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTAGCCGGATCCGACCGCCGCCTTCCTCTGG
CGGTATTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGCAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCA
ACGCCTCGATGAAATGATCCACATGTTCCCGCAGCTCCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGCTGACCGGCCACATTTAGTCGATGTAG
GTACTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATCGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGC
AAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGACAAACACTTCTCATCAT
CCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGA
TATGGCTGGGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAATGGATGGGCCATCCAGATCA
TCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCG
CTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTC
CACTGGCGGGACTGGATCCGTGAGGCGATTACCTTGAGCTCGATCTGACGATAATCCCACTGGCTTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTGT
GTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACCGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGG
AGGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCAGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGA
CGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCG
AAGATATCCTCTGCTTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTG
GTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATA
CACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTT
TTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGCGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTT
TCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATC
CGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCTTAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGAC
GACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGG
TGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCT
GCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGA
GACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCC
TAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTG
AGAGTTGAGA