Description :
From Genome Similarity Track
Location :
scaffold_14:420167- 421276
Sequence
1109 bases(100 bases per row)
AAATTACGTGTCGTTCACGCCTATAACCAGTTGGATTGCCACACGATTCccgcacaaacgccaattctgCGTAAGGATGTCATCACCCACCGTATGTCCG
GCTGTATTCAGTTTAGTGTACGTGTTTTGGGTGACAGATGTTGCCAAATTCTGATGAGGAAGGAGGACGTCTCTTTGACGGCTGTTGTTACACCACTCGG
TATGTTATGGGCGCGGCTTTATGCCAAAAGAATCATCCAATCCCCCAGCAACAATATTTCGGCCATTGCAAAGAATCACACAAACCTTCGCTCATTTGAA
GGACGAAAATGGCATATCTGCCGAAGAAATATACTCGGCGACCATCCATGCTGTCCTAGAATGTATGCGTGGGCATTAATTGAAAGCAATCTTTGATGCT
AGCGAAGTTCCGGCTCTATGTTGGTATGTTTGTGAACACAATGCTCGTGCAGAATTTGAGAAGGTCAAAGCAATCGTTGGGGGACCAAAGCCACAGAAAT
AAAAATGGATTGGTTTGTTTAATTACCTGCATTGTTTTCCGTGTAATCACGCGGAACTGTTACTACCACTACTAAACATGCTGAAGAAGGATGTACCATG
AGAGTGGTCATTCTCTTGTGCAAAACATTCACTTAAATCAAGAACAGTCTGATAGAAGCCCCATTACTTGCTTTACCTGATGATAGAAGTCtgtgtgacg
cttctgaCTTTGCAATCGGTTGTGCAGTATTGCAGAAGGGCTGAGAAGGACACAATCGTGTCGTTTTGatcgcgacagctgaagccaGTAGAAAACAATT
ACCCTGTCCCTATTAACAATAAGGTATGCTATGGTGCAGGCTCGTCTCCAGCATTATGGTTCAGCTCCGTTTGTCGTATACACGATCGCGCAAGTCTGCG
ATATGCAAACAGTCTTTATACTTGTCTTAGTGAATGGCTTGCTTGTTGTCCTTTTTTTGCAGAAAACAACTTCACGGTCACGTACAAGTCGTGAAAACTG
AATTTTCTGGCTGACGCATTGTCACATCGTCCTGATTACGAGCTAGCCCATATTAGCTATATCAAAAACGATGTATCGATAAGATAGGTTGGGTGTAAAT
TGAAGATGA