Description :
From Genome Similarity Track
Location :
contig_26:420150- 422898
Transcript NameFunction/comments
g6483.t1hypothetical protein

Sequence
2748 bases(100 bases per row)
CGCCTAGCAAAGCCACAAGCAACCACGGGAGCGTACCTTTCCTTCTCCCTCCAGCACTTTGAGTGCCTCTCGCAGCAGCCAGGGCTCCATCCCGTGGATA
TCTACCACAAAGCAGCCCGCAATGAGTTCCCCACTCCCTCTTGTACAATTTCCTCTTCAACTTACTCGTTCCCAGCGTCTCCTCTCCAGCATACAGCTCG
TACACCGTAAACACATTGCCCAGCATGCCGTTCTCTTGGGCCTGAAATGAAAGCACCATATACACTCGCGTATGGTCACCACACGATGCAATCATTGCAA
CACAACAAGAAAACATACAAAGTCGTAGATCTCGGCCGCCCACTCGGCCGGCTTCTTCCACATAATGCGACAGCGCGTCTTGGTGTCGTCCTCCCATCGG
CCGTGCCACAGCGCACCAGGTGTTCCACCACGGCCAGACGTCCGTCCTGTGCCATGTTGCGGCTGATTTTCACGTTCTCAAAGAGCGACGAGGTGAAGGG
CTGGAAGATGGGCAGGTCGTGCGCGCGGTGGTATTCGAGCACGAGCTGCTGCCACAGCACGAGCTGCTTCTCGCGCGTGGCGCGCACGGGCTGGAGCCTG
CGGGGGATTCATAGTAAATTTCACATTTCCTAACGTTATTTATTTGTATATATATAGGACCCAGTATTTTTTATAGGTTGGGGCAATGCGGACACGTACG
TGAAGAAGGGAGGGAAGTCGTAATACTCCGGGTACGAGAACTTGTCCATGGCGGCGAGGAAGCGGAGGCTGATGGTGATGTGGCGCAACTATTCCTTGAA
ATGAGATTTGTAGGTTAGAATGGGTACATTATTTATAGATGGATGTAGCTTTACCTTGAAACTAGTGTAGGATGGAAAGCACTTGCTCCTTCACATTGCC
GCCTCAATCTCACCGATGGCACCGTCCTGCGCTATGAGCGCGTGCTCCAGCACAAAGGCTGCATCATCGATCGTCCCGAGCAAGTGGAGAAGCGAAGGTA
GAAAGTCGACTGTAGTCTCCAATCGCACCACTCGCTTGCTCGCTTCATCCCATTCAAAGCTGAGGCGGCACGGGAGGCAAAGACGCTGGCCCAGCAGCTT
CGACCTCAAAAGGGCGGTCTTGTCTTCTTGGCTCGTGTTGTACTGGCCTCCGTCGCCTCCCATCAGGTGTGGAAACACGTTTTGCATGGTCGAGCCCGAG
ATCGTCACATTGAGGGAGCCGGTGGCCGTAGTGAAGTCGTTGGAGATTCTAGTCATGTGTTCCAGCTGGAACTGCAGGTCGTCAAAGTAGCTCGTGCACC
GTTCCCACTGCTCCACGAGCGCATCTATGCCTCGCCGCTCTCCCAGCATCACGTCGCTTGCCACGGATGTCTGCAGGAACACGAGCTGCTGCTGTGCTTC
GGACTTTTGGAGCCAGGCCTCTGGACCAGGGGATACCTGGCGGCTAAGTCGAGTTCCGTTGCGAAAGAGGTGGAAGTACTCGACCACTACATACCACGCG
CTCGACTTGGCGTTGGAAATGAGTCGGCTGTGTTGCATCTCCAGAATCGGGATCTCGCGCTGGAGCTGCTCTACGCTGGTCTCAGCTTCCTTCGCCTGCT
CCGACTGTTTCTTCCTGTAGCGAGCCTGATTCGTGCGGCACTGCTCGCGCCGGCGGGGGGTCTTGATACGAATTCGCTTGCGCTTAGGCTTTGCGGCATT
TGATCCGGCGCTCCGGATTGTTTTGACGGAAGGCACCGTCCTGGATGTAGCTACCGGCTGCGGGAGTGGCTGGGTTGGGTCGAAGAAGCAAACGGAATCA
CTGGAGGCTTAGCGGTCTCGTGCTGCGTCCGCGGGAGCGTTTCGTAGGTGCCGTTGAGTCTTTGGTCGCCCGTCGAGCGAGCGATGCTTCCATCAGATAG
TCGAGAGGTGTCTGCTGCGCCAGGCTTGTTGCCTTCGGCGTATTGAATGCAGCGGCTCGCGTCGGTGGGATTGGCGGCAACGCCTTGATGAACATACCGC
CGCCACCGACGGTCGCTCGTGGCAGCACGTGCCCGATCACGTCGGACGTGAGAGCGTGTGTCGCGCGGCCTAGCTCGACGCGCGCGAATATGCTTGACAC
GCGGTCCATCGAGTTGGGTTGCTGGAAGGTCTGGGAATGACACCACGCTGCTACAGGTTATACCCGTTGGAAACTGGACGCGATGGATGATCACCACGTG
ACTCGTGTTTACTGCAAATACTGGGCCCTTTGTGTCCTTGGGGCATCATCGACCACAGATTTCGATTGCTCTCCGCCACGTGAGGCACTGCTCTTGGGCA
CGTGCTGCTCCTGGAACAGGATATCCTGCTGGCTTCGCTACCATCGCCTTGTGCAGGGCATTTTGCCGGCAAGTGCTCGCGGCTTCAGGATTTGATCCGA
CATGCGGTTCGGGAAACGCTGCATGTCGCACTGGCGCCGTCGGAGAACTGGAAGTGATGAACGGCGTCCGATTCTGTTCAAGCCAATTCGCCCGCAAGAC
ATCCACAATAAATGGATGGTTGCAGGTGTCAAAATGGCTCTCTTCACTTGCTGAGTTCGTGACGAAGTATATCCATCTACAACGTACAAAGCAGCAGTCG
TGATACCAATAAAGGCGTCGACAAGCACGGAAGCAATGGCGTACCACCCCAACTTCGTTCTTGGCAGCAACCGCAATCTGCACTGAAAGATCAGCGACTT
CCTTTTTGTGCATCTTCAGCTCGGCACGAAGCGACTCGACCGACTGCT