Description :
From Genome Similarity Track
Location :
contig_26:420117- 422865
Transcript NameFunction/comments
g6789.t1hypothetical protein

Sequence
2748 bases(100 bases per row)
CCATCGAGTTTGGCCGTCGCCTCAACGCCGGGCTCTTCAATCAGCAGGGGCCTCGGAGCACCAGAAACTTCCTCGCTTGCCGCTTGGCCAGCTTGGTGGT
GGCGATGAGGGTTACCACGGCGGTGATGTCGACGACGGCGTGAAGCCTTAGCGCTGGCCGGGTGGTTTGCTTCCTCCATTCAAGCAACAGCTCAAGCAAT
TTGCTTTGTGCTGCTGTTTGAGCTGCAGCGTGTACGTGTACTAACAAGAAAAAGACCGTTGGCGGTCAAGCCAACACAGCTCTTTTCCCACGAACCCATC
ACAGCGAGAAGACCCGCTTCACACGAGGCAGTTGGCATGAAAAACAATCCTCGTCGCTTCACATTATCATTACACGACACCCATCGTACCTCTTCTCATT
TGCTGCACACAGTTCTCTATCGAAACGTCCACCTCGTGCTTAGTCCGTGGTAAGGAACTTGACGCCGTCTTCCTCGCACGTCTCGCCGGCAATCACCGCA
GCCTGCAGCAGCAATTCATGAGCCAGCCGCCTAGCAAAGCCACAAGCAACCACGGGAGCGTACCTTTCCTTCTCCCTCCAGCACTTTGAGTGCCTCTCGC
AGCAGCCAGGGCTCCATCCCGTGGATATCTACCACAAAGCAGCCCGCAATGAGTTCCCCACTCCCTCTTGTACAATTTCCTCTTCAACTTACTCGTTCCC
AGCGTCTCCTCTCCAGCATACAGCTCGTACACCGTAAACACATTGCCCAGCATGCCGTTCTCTTGGGCCTGAAATGAAAGCACCATATACACTCGCGTAT
GGTCACCACACGATGCAATCATTGCAACACAACAAGAAAACATACAAAGTCGTAGATCTCGGCCGCCCACTCGGCCGGCTTCTTCCACATAATGCGACAG
CGCGTCTTGGTGTCGTCCTCCCATCGGCCGTGCCACAGCGCACCAGGTGTTCCACCACGGCCAGACGTCCGTCCTGTGCCATGTTGCGGCTGATTTTCAC
GTTCTCAAAGAGCGACGAGGTGAAGGGCTGGAAGATGGGCAGGTCGTGCGCGCGGTGGTATTCGAGCACGAGCTGCTGCCACAGCACGAGCTGCTTCTCG
CGCGTGGCGCGCACGGGCTGGAGCCTGCGGGGGATTCATAGTAAATTTCACATTTCCTAACGTTATTTATTTGTATATATATAGGACCCAGTATTTTTTA
TAGGTTGGGGCAATGCGGACACGTACGTGAAGAAGGGAGGGAAGTCGTAATACTCCGGGTACGAGAACTTGTCCATGGCGGCGAGGAAGCGGAGGCTGAT
GGTGATGTGGCGCAACTATTCCTTGAAATGAGATTTGTAGGTTAGAATGGGTACATTATTTATAGATGGATGTAGCTTTACCTTGAAACTAGGGTAGGAT
GGAAAGCACTTGCTCCTTCACATTGCCGCCTCAATCTCACCGATGGCACCGTCCTGCGCTATGAGCGCGTGCTCCAGCACAAAGGCTGCATCATCGATCG
TCCCGAGCAAGTGGAGAAGCGAAGGTAGAAAGTCGACTGTAGTCTCCAATCGCACCACTCGCTTGCTCGCTTCATCCCATTCAAAGCTGAGGCGGCACGG
GAGGCAAAGACGCTGGCCCAGCAGCTTCGACCTCAAAAGGGCGGTCTTGTCTTCTTGGCTCGTGTTGTACTGGCCTCCGTCGCCTCCCATCAGGTGTGGA
AACACGTTTTGCATGGTCGAGCCCGAGATCGTCACATTGAGGGAGCCGGTGGCCGTAGTGAAGTCGTTGGAGATTCTAGTCATGTGTTCCAGCTGGAACT
GCAGGTCGTCAAAGTAGCTCGTGCACCGTTCCCACTGCTCCACGAGCGCATCTATGCCTCGCCGCTCTCCCAGCATCACGTCGCTTGCCACGGATGTCTG
CAGGAACACGAGCTGCTGCTGTGCTTCGGACTTTTGGAGCCAGGCCTCTGGACCAGGGGATACCTGGCGGCTAAGTCGAGTTCCGTTGCGAAAGAGGTGG
AAGTACTCGACCACTACATACCACGCGCTCGACTTGGCGTTGGAAATGAGTCGGCTGTGTTGCATCTCCAGAATCGGGATCTCGCGCTGGAGCTGCTCTA
CGCTGGTCTCAGCTTCCTTCGCCTGCTCCGACTGTTTCTTCCTGTAGCGAGCCTGATTCGTACGGCACTGCTCGCGCCGGCGGGGGGTCTTGATACGAAT
TCGCTTGCGCTTAGGCTTTGCGGCATTTGATCCGGCGCTCCGGATTGTTTTGACGGAAGGCACCGTCCTGGATGTAGCTACCGGCTGCGGGAGTGGCTGG
GTTGGGTCGAAGAAGCAAACGGAATCACTGGAGGCTTAGCGGTCTCGTGCTGCGTCCGCGGGAGCGTTTCGTAGGTGCCGTTGAGTCTTTGGTCGCCCGT
CGAGCGAGCGATGCTTCCATCAGATAGTCGAGAGGTGTCTGCTGCGCCAGGCTTGTTGCCTTCGGCGTATTGAATGCAGCGGCTCGCGTCGGTGGGATTG
GCGGCAACGCCTTGATGAACATACCGCCGCCACCGACGGTCGCTCGTGGCAGCACGTGCCCGATCACGTCGGACGTGAGAGCGTGTGTCGCGCGGCCTAG
CTCGACGCGCGCGAATATGCTTGACACGCGGTCCATCGAGTTGGGTTGCTGGAAGGTCTGGGAATGACACCACGCTGCTACAGGTTATACCCGTTGGAAA
CTGGACGCGATGGATGATCACCACGTGACTCGTGTTTACTGCAAATAC