Description :
From Genome Similarity Track
Location :
scaffold_14:420117- 421276
Sequence
1159 bases(100 bases per row)
GTAAGGGGAGGCATTTCCCCTCACAGCGCGCCGTTTTGTGCGCCCAAACAAAATTACGTGTCGTTCACGCCTATAACCAGTTGGATTGCCACACGATTCc
cgcacaaacgccaattctgCGTAAGGATGTCATCACCCACCGTATGTCCGGCTGTATTCAGTTTAGTGTACGTGTTTTGGGTGACAGATGTTGCCAAATT
CTGATGAGGAAGGAGGACGTCTCTTTGACGGCTGTTGTTACACCACTCGGTATGTTATGGGCGCGGCTTTATGCCAAAAGAATCATCCAATCCCCCAGCA
ACAATATTTCGGCCATTGCAAAGAATCACACAAACCTTCGCTCATTTGAAGGACGAAAATGGCATATCTGCCGAAGAAATATACTCGGCGACCATCCATG
CTGTCCTAGAATGTATGCGTGGGCATTAATTGAAAGCAATCTTTGATGCTAGCGAAGTTCCGGCTCTATGTTGGTATGTTTGTGAACACAATGCTCGTGC
AGAATTTGAGAAGGTCAAAGCAATCGTTGGGGGACCAAAGCCACAGAAATAAAAATGGATTGGTTTGTTTAATTACCTGCATTGTTTTCCGTGTAATCAC
GCGGAACTGTTACTACCACTACTAAACATGCTGAAGAAGGATGTACCATGAGAGTGGTCATTCTCTTGTGCAAAACATTCACTTAAATCAAGAACAGTCT
GATAGAAGCCCCATTACTTGCTTTACCTGATGATAGAAGTCtgtgtgacgcttctgaCTTTGCAATCGGTTGTGCAGTATTGCAGAAGGGCTGAGAAGGA
CACAATCGTGTCGTTTTGatcgcgacagctgaagccaGTAGAAAACAATTACCCTGTCCCTATTAACAATAAGGTATGCTATGGTGCAGGCTCGTCTCCA
GCATTATGGTTCAGCTCCGTTTGTCGTATACACGATCGCGCAAGTCTGCGATATGCAAACAGTCTTTATACTTGTCTTAGTGAATGGCTTGCTTGTTGTC
CTTTTTTTGCAGAAAACAACTTCACGGTCACGTACAAGTCGTGAAAACTGAATTTTCTGGCTGACGCATTGTCACATCGTCCTGATTACGAGCTAGCCCA
TATTAGCTATATCAAAAACGATGTATCGATAAGATAGGTTGGGTGTAAATTGAAGATGA