Description :
From Genome Similarity Track
Location :
contig_11:420066- 421760
Transcript NameFunction/comments
g3262.t1hypothetical protein

Sequence
1694 bases(100 bases per row)
ATATTCGCGCTGGGGGCGGCTGCGTGCTACGGTGGCCTGTTCACGGTGCTCTACTACTTCACGCGCTACCGAGAGCACATCAAGATGCAGCTCGGCGCCT
TCATGGAGACTGCGCAGACCGGAGACTTGCGGAAGCACGTCAACTTGCGAGCGGACCGGAAGCTCAACACGACCAAGAAGATCATCCCCGTCGTGCGAAC
GCGACTTTATTACGCTACACGTCGCGGTGATCTGCACGAGATGCGCGAAATTCTAGAGTACGCCAAGACAAAGGACTCACGAGCAGCGAGATTGGATTTC
CCCGCAAGATTTACGCGGCTCCGACCATCAGATGGCGGTTCTTCGCAAGGTCGAGCGAAAACCCGGTGCATATAGCTGCTAGCCTTGGCAATATTCGCGC
TTTAGAGCTCTTACGAGAGTTTGAGTTTGACTTGGCAGCACTAGACAAAGTGCAGCGAGTGGTGATTTCGACCGGTGGGTTCTTCTGGCACTTCATCCAG
CTCGTCGTCAAGCGCCCCGAGCGCAGCGACGAAGACTCGGCGAACTCAATCTTCCACACAACGCTGGTCACGCCGCTGCATTGTGCAGTTGTTACAGGCC
AGCTGGAGACTGTGCGCTGGCTGCTGGAGCGAGGAGCGCCTCCAGGAACGCTTGCCCAGGCGTCATTCAGATCGAACCGCATCCCGCCGCTGTATCTGGC
TGAACATGGTGAAATCGCTCGAGAGCTGCTGCTGCACGGCGCTGACCCGCTCGTGATCCCCGACCCAGGATATATGAACACCATGACGCCGCTGCAACTC
GCGTATGTCCGCGGCAACTACGCGGTGGCTCAGGAGTTGGAAGAGTGGGGCAGTGACGTCGCGCTCACACCATTTCACCTCGCGGCAGCCCGCAATAATG
TCAAAGCGGTGCGAAAGTTCATCGCGCGCAAGACGGACGTGGACTGTCTGGGTGAAATGGGCTACGTGGGTCTCAATCGCCGCACGCCGCTGCACTGGGC
TGCTATCAGCGGCTCGGCGGAGGCGGTGAAAGCGCTGTTGAAAGGGGGCGCTGACCCGAATTTCCAAGATGTCCGTGGACGCTCGCCGCTGCATTGGGCA
GCAAAGCTAAATAAGCTGGAGGTTGTACACTTGCTACTTCGAGCTAAAGCTGACCCCAATCTGGTTGACAGTGAGTACATGACGCCGCTCATGTGTGCTG
CCTCCGCGCTGGATGCGTCTCGGGAACTCTTCAGTGAACTGACATACGCAGGAGGCAACATCGGCTACCAGTTGCCGATAACGGGCGACACTGCGCTGCA
CGTTGCTGTGCGAGAGGAGAACCAGGAGTCAGCACTTGCTGTCTTGGCGAATGGTGGTGACCTCATGCGAATGAACAACGAAGGGCTACGTCCACTCGAC
TGCACGGCGAATACGAGGCTACTCTTCGAACTCAAGCGCGCCGCTGGTCAACGCGATGTCATGATCAGCTACACGCACTCGCATCTGGAGTTCGCGCGCA
AGCTACGCCAGTCGCTCGAGGAAGCCAATATCACGACGTGGTTGGACCTGATGGACCCGAGTGGCATCGGCGGAGGTGCCGTGTGGCGTGAAGAGATCGC
TCGTGGCATCACGAATGCATCCATTGTGCTCTGTATCCTGACTGAGGACTACGCGTCTTCAGAGTGGTGTCTGAAGGAGCTGGCGCTGGCCAAG