Description :
From Genome Similarity Track
Location :
Scaffold_1559:4200- 5991
Transcript NameFunction/comments
Phyag_g10967ethanolamine kinase, putative

Sequence
1791 bases(100 bases per row)
CCAGAACAAGTGCGACGCAAGCGTGTAGCGGTTCACCACGTCATACAACGCGTGGAAGAAAGCCTTGGACTCGCGGTTAGCCTCCAGCTGAGCCAACATC
TTGGGTGCCGCCGTGCTCATGTAGGCCTTGAAGAACGCAAACTGCTTCTCGATACTCGGGTATATCCCCAAATCGAAGTCAAAACCGCAGTTCTCGCAGA
AGTGGTTGGCAAAGTCGAACGCGCGGAAGTTGTAGCCGCCGTACTCATAGTCGATGATCTGCACACGGTCCCAGTCCGGGTTGTGCAGGATGTTGCCACT
CAGCAGGTCGTTATGGGAGAACACGACGTCGGAGGCGAACACCTCTGCTTGCATCGTGATCTCGTCAGTGTCAAGTGCGTCAAGCAGGTCCTTTCCGTTT
TGGTTCTGGTTCGAGGGAAGCACCGACTtgagccactgcagcttttggtGCATGGTCGGCaggtccagctcctccagcgttgCATTCTTAACAgggtcgt
ccagctcgatctccatcgccagcttctcgaaaCGCTCGATCTTGGTCCACAGCACAGGCTCGCGAGACTCGGGGATATCCATAAGGTGCATGACGCCAAG
CTCTCGGCCGATCATCTGCAGGTAATTAATGGGCTTGGTCAGGCCCATATCTTCAGGCTCGAGCGGTCTTGCATCCAACCAGCCTTCAATTCGGCCGTTC
TTGAAGCGGCCGTAGTACGTGGGGGCAAACCCGCGCTCCGAGAGCAAAGCGaacagcactgcaacaccgAAACGAGTAGAAAATGAGTAATCTGGTGAAA
TAACTTCAACTGCAACGACGCACGTACTGTTCTCGATGCTGCGGTCGATGAATTCCTCTGTGTGGTCTCCATACAGacgcaccagcaccgactaGGCAGC
AGTCAACCCAAGCAAACAACACGTCAGTCATTTCAACGAGATGCACACACCTCCACAGTATACTGCGGTGCTCACCTTGTCCCCCCACATGAGGCGATAG
AGGCGGTTAGTGATGCCGCCCACGATGATCTTGACCGAGATGTCATCGTTCGCTGCATTTTTCCTGCCACGTCAGACACGACAGCTGTCTCGTTAAACAA
CCGTTGACGTCAACAATCCCCATTGCTatctctctctctctctctcaccAGTCGGGGCAGATCTGCTTCACCACgaacttggcgtcgtcgaactcgtcga
ctcctccagctcccACCGCATAGTCCAGACAAGCGTCCGCATTGTTCAGGTAGACAACTGACATAAAGAACAACATCCACTGTGGGTTAGTCTCTCTTCC
TCTTTGCCCCCCTCTTTGCAGCAATAGACGCACCTTCTCCTGGCAtattttcttcttcttcagagGCTTCCGAGTCGCTGGGTGacgctgaggaggagga
cgatgagggTTTGCGTTGGCGCCTTTGACGCTTTTTTGTGCTTTTGTCGCTCCTGCGGCGCGCGGATCGACGGGAAGATCGAAAGTGGCGCCtgtcgagc
agcaggaagatgcTCGCGGCCGTGAGGGTACaggtggcggcggagacGAGGGCAAGGGCGCGCCAGTTGAGGTTCGCGTTGGGCTCTGCTGGCATTGAGT
GCAGATTGAAGACTGGAAGAGAGAGATGCTGCGGTCTTCGGAGCCCATTTATGGCCAATCAGAGAGAGCGGATGCGTCTGAAAATAGAGACCTTGAGACG
CGGTATCATCTGCGTTGCTCCTCCCATCGTCCACCATCTCCCTCATGGCCGCCGATGCAACCACGCTGCAACACGCGTTGCGCGTCAGCCT