Description :
From Genome Similarity Track
Location :
Scaffold_2049:420- 4161
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2049-snap-gene-0.4Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_2049-fgenesh-gene-0.0Nucleolar GTP-binding protein 2

Sequence
3741 bases(100 bases per row)
TTGGGCTTGCCGATGTGCAAAGTCGGGGCCAAGGATACGCTCGAGCTCTGCATGTTGCACTCGTGAGGTTGGGTGGTGGACTTGGCTGTTGCTCTGGGTG
TCCATGGCGACGCTGGCCACCGCGACAGTATCTTGTTGAAACTGAGCAGGTGGGCTGCCCCCTGCCCTGGATTTACTCGGGACCCACCTTCGAAGTACAG
GTTGTACTGTTGGGCGGCGGGTCCATCCTCGCTTGCTGACTCGACGTCTTGCTCGGGATCGCAGTTCTTCAATCGCGGCCAGCTAATGGACACTCACTCG
GACACAGCTGCCTTCCGCGAGGTGCTGCAGTTTGGAGCTTTCCTGCGGCAGAGAGCTGCTGTCACAGAGACACGACCCAACGATGTGAATGCTCGGTTGC
CAGTAGCGGCCGGCAACGTTCATGAACTTGCGCTCGCCGGCGTACGATGTCCACGTGCGTAGCTGTGTACGTCGTGCTAGCGCTGGTCATTCGGCTCTCC
CCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCCCGCGAGGCGATTACCGCGGCACCAACTCGGGTGTCA
GCATGCTCTTTGTGATCGAGCACTCCCTTATCTCTTCCTGAGTGTCATGCAACTCATGCTTGACGGCCGCAAACGTTTTCTGCGAGCGCGCTGCGCGATT
CTTTGGCAGCGCCGCGCCCGCAGAGGAGTCGTACGTCCTCATATCGGTGCTTCTGTCCAGTGCCGTCTTGTTTCCCATGGTAGGCTTCTCGGGATTCGCC
ATATTCACGGAACTCGGCCAAAACAATACTGCTCTTACTACTACGGTAGATCTCATAGGGACGCCTCCGCCTTGGGTGGCGATGCAGTCGATTGAATCCC
TCTTTGTTGAGATGGTGGCGGCGCTGCGGTGTCCCTGCATGGCGAGTTGCACAATGTTGAGCGGTGGTCACGGCCATGATAGAGTCAGGACAGAGCACAG
GGGGATGGAGGGGCCAAAGGCTCCGGGGCTAGGCTGTTGGTGCTTGAGATACTGGCAGTGAATTTCCAATTGAGGCTACAGGTTCAGCCCCTCCGATACT
TTTGTTTTTGATTTTTTTTTTTGTAAATCGACTTCAAAGTTTGGTATCATAACTTGGTAATAAACCTCTTTTTATGGGAAAGGGCGTTAAAAGATTCAGG
TCCAGATACAACTGCTGTTGTCAAAATAAACGAACAACGTCAAAAATACCTGTTTCGACAGGGAAAGTGCCTAAATAGCTTACAGACACTTTATGTTTTC
TTTGGAAATTAACATAATTGCTGTTTAGCCACCATAAACACGATTTACGAAATATCTAATCTGAGAGAAAAAGGGATAAAAGGGTCCAACATGGGAAGCT
CACTGTTCCATGGAGGCGAGAATGGCGCCAGCGGCGGCCGACGAGGCTCGGTACGTCGTCCAGATCGTGGTCCTCGCCGCCTGCAGCGCCGGCAGACTGA
ACGTGCGCGCGACTGTGACGTAGGGCTTGGCGTACTCGCGCACAGTCTGGCCGAGCGGCGTGGCCGCGACAAACTCGAGCGGCTCGGCGAGGCAGCGCAC
ATAGAGGCGATCAAAGAGACTGCCGCGGTGCGCGACAAAGACCGTGTTGCGGTGGAGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGAGCAGAGCAGATAGCTGCCGCTGATTTTCTTGACCGTGAGCTCGAGGTCATCGAGCGGGGTGACGAGACACGAGGGGTACGCGCCGAATCCC
TCCATTTTCACGATGTCCCCAACGGCCGGTTCCATGCCATGCGGCTCGTACTGCAAGACGACGCGGACTTCGCCGAGCATGAGTTCCTTCTCGGGCTGCT
TCTTCTGTGCGGCGCTGCTGCCTTTCTTGCCAGCAGCTCCAGTTGCTCCCGGGCGCAGTACCATGGGCATGCCGCCGCTGAGCGTGATCCACTTGTCCAT
GACGTCTTCCTTTCCTTCGAGCAGCGGCGTGAGGTCCACGGTCGCCGTGCCAATGACCGAGCCGTTCGTCATGCCCACGACCTCGGTCGCGCGGCCCGTG
AGCGAGTCCTCATTCATGACATCCACAATCAGCTCGAGGCGCACGTTCGAGTGGTCGTCCAATTGCGAGCCGTGCTTGGCGTCCAGCAGCTTGTGGATCT
TCATCTCGTGGAGCTCGCGGCGCCACGTCGGGTTGTCATTGCTCTCAATCGTCGCGCTGCGCGCGGTCTGCTTGCCCAGCCGGAAGATTACATAGGGGTT
ACACGTGCGTACCCAGAACATGGACGCGGCCGCGCGCAGGTTACGCGCCTCCAGGAGCCGGATCGTGACGGTGCCGGCCACGCCGTCCTGGTGGTGGAGG
TGCTTCTCGAAGAGAAACGCGGGATCATTGACGCGATCGCCGGGCACGGGAGTCGCCATTTTGTTGGAAGTTGGCCGAGTTGGCGTTGGGAAAGTTGGGA
GAACGGGCCAACAGAAGGCGCCGCGTCCCGGCAAGAATGTGGAATGGTGAAGCTCTTCGAGTGTCGAAGTTGACGCTGGATTCGTCGATACGGGTTCGAA
AACCTGTAATTCGTAACAAAGCGTTAAGAACTTGATACTTCCTGTTAAAACCGGAATCGAGAGGGTACGGTTACGTATCGTTTGATGAGGTTACGCTTTG
AGTTGGCCACCAATCATTTGAAGCCGTTGCCTCTGTGAAGAGCTACTAACAGTCACGCCCTGATTGACAGGACCGCGGATCGCGGGCCTTCTTCCACTTC
GTCGCTGAGCTGCTCTTCGCCACACGCCGCGTCGCTCCTGGCAACCTCTTCATCTTTAGCTCTCTTGCGCATCAGTCTGTGCGACTCCGAGTCTCTGGAT
CGTCTTAGAAGCTAAGCACCATGCCGCCGAAACTCAAGGGCATCAACTCGAAGAAGGCGAGCGCCGACAACCCGCACCGCGCGATCCCCAAGCGCCAAAA
GGCCGCCAACATGCGTGACAAGTCGACCATCAACCGGCTCAACATGTACCGCAACAGTGGGCCGATCCGCAACAAGAAGGGCAAGCTCGTCGGCGGCTCG
CTCATGATGGGCGACAAGGCCGGCGGCCAGGCCATGTCGGGTGGCCAGGCGCGCATTCAGCCGGACCGCCGCTGGTTTGGCAACACGCGCGTGATCGGCC
AGAAGGAGCTCGACAAGTTTCGCAACGAAATGTCGCTCAAGCAGGCCGATCCGTACTCGGTCGTGCTGCGCACGCGCAAGCTCCCCATGGGGTTGCTCCA
GGACGCCGACAAGGTCGCGCGCATGAAGCTGCTCGAGACCGAGAGCTACGAGGACGTCTTCAACGGCAAGCGCACGCGCAAGCGTGCCAAGATTGCCGCA
AATGATTACGAAGCGCTCGTGAGCCGCGCGGCTGAAAGCGCCGAGACGTACGGCTCCAAGGTGGACCGTAATATCGTCGTGGAGCAAGACTTCAAGGTCG
AAACATCCCATGACGTGTTCAGCAAGGGCCAGTCGAAGCGC