Description :
From Genome Similarity Track
Location :
Scaffold_1882:420- 1994
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1882-snap-gene-0.0Cleavage induced predicted protein

Sequence
1574 bases(100 bases per row)
CCTTCTCCGAATTGGTCGCTCTTGCTACCGCGAAATTGGATCGCGATCTTCGCGGCCAGGTCGAGAACGTTACACGGGCGGTCACTGGCCGTAAGGAAGG
TCACGTCTTGACGGTGGATTGCGTACGGCTGCGTTCTTGAGCCGTTTGCGAGATACTCCGACCGTCTTAGAAGAAAGAAGAAGCCCAAGACCGTAGCCCC
CCACAATACACGGTCGCGGGCTTTGGAGAAATCGAGGGAGCGATGGAGCTGTCGCAGAATTGTGGTTGTAACTGGGCTTTTTGGGTTGGCTGGGGGGTCA
GACCGTCGCATTCCAGAGATGGCAAGCTGATGTCCTGGGAGCAGACCGACTCTGTATCCGATCGATCTTTGATGATACCACGATATGTGGCTGATTTTGG
AGAGCACGGTCGAGGCAGAGTTTCCTGCTGCATCCGACCACCCGTAGCGCCAACAGTACGTTGCGAAGAGAGCGAGCTGGTACGAGTGTCGTTCTGGTTC
AGCTGGAAGCCATGGGGATGTCCCGACCCACTTGCACCATCTTGACCACTGGGACCACGTGCTGGAGTACTTGGTCGCCGACGAGGTGGCCAAAGATCGG
GACTGCAATGCTCCGAGAAGCTCGTGTAGAGTTTCCTGTAGTGTGGCGGCACTTGCGCCTGTATCCATGACGCAGAAAAGTTAGTCCATTGTGACTTGAA
CGGTTCGCTCCAGGCTCGGGAAGCTGCGTCTGCCATCCGGTTCGTCGAACCCGCGAGATGTTGGGCTGATATTCTGAAGTTGAAAATCGCCTCGGCAAGG
CCAATGGCCCGATTAATTTCTTGGCCCATGCGGTTCTTCGAGAACTTCCGGTTGCTCCATGAGACAGCCGAGGTGTTGTCGCTCCAGCATTTTATGTGTA
TCGTTCGACCGGCATATTGGTCATACCAGGTCGGCGCCCATGTCCACACAGCGAGGGCAATGCATAGATGTTCGCGAACATTAATTGAGAAGTCGCCTTC
ATTTGTCGAGACGTCCGTCATCAGCTCGCGTTCCACGTCGTCGAACTTGACTTGGATAAACTGATCTATTGCAGGGTTTAGCACAGCCAGTCCATCGTTT
GACGCGTCCATGTACAAGTGAACGTTGGGGTTTGGCAGGTCGCCGAACATGCTCAGTGGTAAATCCGCAAGGTGTCCACGGTTCAGGATATGACTAAACC
AAGTGAGATCGAGGCGTGAGCCAGGTGACAGCCGCTGGGAACCAAATCGCGGAGCATGCTTGCACTGTCCGTGCAACCGTTGGTAGAATGGTTTTGCCGA
CGGAAGACAGGCACAAACGTGGCGAAGACTCCCCAACAATTGCTGCAGTTCCCGTTTTGTAGCCTTGCCCTTGCGGATCATAGTCTCGACGCGCTGTAGA
GCCTTGCCGGTTTTTTCCTCGGGCATTGAAACTGTCCGGGCCACTGTGTTCCATTTCAGTCCCAGTGCGGTCAATTCCTGCTGCCAGCCCGAGAACTTGG
ATTCGTTAATCGATCGTGGACCTAGGACGGCTAACATGGCGTGCCGGAGTGTTGCTTCTGCTAGCTGGAGGCGA