Description :
From Genome Similarity Track
Location :
Scaffold_2893:420- 1719
Transcript NameFunction/comments
Phyra_87942taurine dioxygenase, putative

Sequence
1299 bases(100 bases per row)
TCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCCATCAACATCGACTCCACCTCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCA
AGAACGCGCTCAACCAAGAGGTCGAACATGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCC
GTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCACCTGGAGCCGAAGATTGGCACGGAGATCTCG
GGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGA
TCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAA
CTCACTCGAAGTTAGCGAGAAGCGTATCAAGTCGCAACTGTATGATCATGTGAATGTGTGGCACAGTGATGTGTCCTATGAGCGCCAGGTGAAGAAGTTT
GGGGGGGGGGGGGTATGTTCTGTACATGTTTAGTATATTAACTTGTGTGACTTGTAGCCTCCATCCTACACGAGTTTCAAGGTCTTGACTACACCACCCA
CGGGTGGAGACACGCTGTGGGCGTCTGCGTACGACGCGTACGAGCGTCTTACCCCACAATTCCAGAAATTTGTGGAGGGTCTCACCGCTATCCACAGCAG
CAAGGTACGAGATGCTCTTTGACACGTATGCAAATGTCTTTGGATGGAGCCTCATTCTTTGCATGTGAACTGATACAGAGCCAAGCCGAGAGCGCAATCG
CCAAAGGTCAGACCCTTCGCCGCCCTATCGTGGAGTTCGAACACCCGGTTGTTCGCACGCACCCGGTGACGGGCCGCAAGGCATTATACGTGAACAGCCA
GTTCACGACTCGCATCAACAACTTGTCTGCTCCCGAGTCCGGTACGTTCAGTGCGTCGTGTTCATGATATCGATGCCAGTGTGCTGATAGCTCTGTGTTG
GTCCTTCAGACGCGGTCTTGCGTTTTCTGCTCCAGCACATCGCACAGGGACAAGAATTTCAAGTGCGTTACCACTGGACCAAGGACTCTGTGGCCATTTG
GGACAACCGAGCCACGATCCACTACGCCACGTACGACTACCTGCCCGGCAACCGCCACGCTGTGCGTGTGACGCCTCATGGCGAGATCCCGTACTTCGA