Description :
From Genome Similarity Track
Location :
Scaffold_4024:420- 1608
Sequence
1188 bases(100 bases per row)
GCGGGCTTGGGTTTAGGTACGTTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACT
TGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTC
CCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAG
CATCTTCTTGGGACTCACGGTAAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGATATTGCCA
GATTCAACTTACCAACTGCGCCCAGACACCGGCTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTA
GGGCGGGATCTTGCTCTCTTGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGTAGCAGTGGAAAA
TCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGC
GGGTGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTCTAGGGTATAACCGACCAAGTA
GTAAATTCGGTTAACCCGTCGAATCTGCACGTGTATGGGAAAGCTTACTAGGTTGTAGGAACTGGCCAATGTATTATCCAGTTATCACTACCAACACTAG
ATTCGCAATTCGCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATGGTGCAAATGAGGTTCTG
TATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCATTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTG
ACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGCCACCCTATTATGGGTACACTTATCCGG