Description :
From Genome Similarity Track
Location :
Scaffold_2240:42- 4138
Transcript NameFunction/comments
Phyta_totarag14279hypothetical protein

Sequence
4096 bases(100 bases per row)
AGGCCGCCAGATCAGAGCTTGATTCAATCACTCTCATATCTGGATAAATATACGGACGCAGTGTGAAGATTTCCACGCTGTTCCATCCATCCCCgcgtct
cgccaagacgttcaagactTCACATTCTCACACTTCGGCAATGACCAagagagcagatccagcccaccgacgggtacacaaggtgaccagttcagcagat
cacggatcacCGGGGGaccctccgttagtcggtgcCTGGGAAAAGTGGGAAGCCGGATTCAGTCTCAGTGAGATTTTGACGGATCTCGCTACACCACAAC
AGCTCGACTCCacttgtcttcgtcatctgTTGACCGATCTCCACCATTCTTGACCACTTCTGGCGTCGAATCTAGTTTCGATCTGCGTGCGATCTCATAG
AAATCGGCTTCTCGGAGCTCGTATAGGACCGACGCGTAGATCGCGAAGTCCTAAATGAAGCGACTGTAAAAACAAAATTGAGACTCCTCCAAaacgactg
catcgatctCAGCGTAGTCGGTAAAGGTAGATCGGTCAGCGACAGCAGGTCCTTCGGGTGAGGTTCCAGTCCGTCCGCGGACACCTGATGGCCCAGNGAG
GATGTCGTCAATATAAGATCGACACCCTAGCACCGACGATTCCTTTCCTTCGTCAGGTACTCCCTCCTCGAATACGTCGGTCTAGTTGGCGTGATCTTGA
GGAACCCATACAACGCATTGTCCACCAACCTCTGGTAGATCTGCGGCACGTTCTTCAACCTAAACGACATTCGATTCCATTCGAATAATCCGAAAACGCC
GGGATCGCGCGCGCTCTATCAGTCATAGACACCACCCAAAATTCACTAGCCATGTCCAACGAGCAATACCAGATGAGCTTGTCAAGATCGTCGAGTAGAT
CGTTGATAAGCGGCATAGGGTACACCATTAGTCGAGTCAGGTTGATCAGGTGGTAGTCGATACAGAGTCTCATGTCGACTCcattcttcttgatgatTAC
GACGATCGGAGATGCCCATGGCGAGGTCGAGTGCCGGATGATCTTAGCTAATAGTATTCCTTTGATTAGCTGGAACAGCTTCTCACGGAACTGCGAAGCG
ACCTTGCGGACCCGTTGGGCTAATGGTCTTGCATTTTCCACATCAATGTCGCAAATCCCTCCCTTCGCATCAGATGACAAGGCGTTCCCCTTCCCAATTA
GAAGGTGTCAGCGACGCCAGTTGATCTTCACTAGtcgctcgatctcttccgCGTACTGTCCTCAGGGTTTCCCACTTGGATATCCTCGATCTTGACTTCT
tccgtcgtcgacgtgaCCTCCGGCAATACCGCCATGTGACCCTCGAGATNCTCAGGGTTTTCTCCAATCCCTGCAAGTCGATCTTGAATGCGTTTCTGAT
TTCCACCCATCTCTGCACCTCGATCTCGGCAATCACTTGAATCCTGACATCTACAATCACCTGAACCCTGACACTTGAATGCTGACATCTGCAGTCTTCT
GCATACATCGCCCTTTCTGCATCCGATACTGGGCGCTTGGTACACTCATCGGTGCTGACTTGTACATTCCCAGCCGGTGACAGGCCCGCGTTTCTTCCGT
CGTTGAGGCGCCTTCTCACAGAATCCTTTGGTCGTGTTCTCCGCCATCTCTGtcgtcgccaccgccgaGCTCTGCCACGTTTTGGCGGTCGCTCCAGCGG
CCGGGGCAAGATCGCAGTCGGTGTCTTGTACTGTGGCCGATCTACGGCAGGCTCCTGTGGCTCCTCAATTTTCTGGCGATCTTCATCGACATCCATCGCC
GCCTTGGTAGGCCAGGCTCTGCCATTCAGCATACCTGCGCGATCCCACCGAGATATATCCAAGTAAGCGTGGCACTCGATCTCCGGCCAGCCACATTCCA
ACGCGCATGTTGCGATCCAGTACTAACTTGCGGTCGCTCACGTTTATCAGCTGCAGGTAGCGTGTCTTGCCAGGACAAACTGTCAGGGTAGGCACCCAGC
GACCTCCGTGGGTTACCCACAGCTACCGACTCTCGGTGGTTAGCTTCACCTCTGTCGACCCTCCAACGGCGACGTATCGATCTTCGTTCAAGGTTACTTG
TTCCACGTGGTCTCCGTAGAGTGGTCGTCTGCCGGCCAGTTGGACACGGACTTCACCGGGGAGACAGATTGTGCCGTCGGCAAGATCAAGACGGATACCA
GCAGGaaccatgaagtccatgccGAGGATCAAGTCCTGGCCGCCAGTTGACGGGCCTACCCagacgtcgaagaagtagATCAACGATCCAGCGAGCGTGA
TCTTGAGTCTGGTACGTACGTCCGCCGTGTGCAGGGATTTACCAACACCTTCACATCCCAGTGTCTGACTTTCGTCAATGTAGCACCCAGCTTTACGAGC
AAAGGCGGTGTCAATAATAGACACCTCGGCACCACTGTCAAATACCATGGTTGCTTTTCCGTTGTTGATCTTCCTCACAGCTTTCGCTtgcttgaacttc
ttgtcaGGCATGTGGTACTTCCAGTATCCACGCGATTCTCCTGGCGAAATGTCCAACGCCATCGTCACACTTGATCTCGAATACTCATCAATCTTGTGCA
AACTTGACACAGCAGTGGTAGGTGTTCCATGAAGATCACATGTATTGTCGATCGGATTCATATGCTGGCTAACCATCGACTCCGATTGTTTCTCGACATA
TGCATAGACGCAATACCCAGAACGCTCGTCTCGTACCGGGTTCAAAATCGGCGGGCGTCCTAGTTTAACatcttctccgccgtctccgccAGCATGTCTG
CGTGCTTGATGGAGTTGAACCACTGACGGATCAAGTTGTAAAACACTTCCATCGGGCATTGGCCAGCGTCGTGGATCTCACCGCAGGCCTTGCACACAAA
GAAGCATCGGTTAGATGGATGCCCCTTTCGGCGACACTTTTCGCAGGTCAAGCGTCCCTAAGCATCCAAGATCGGTATGCTTGCGCGACCCGCAGTGTGA
GCAGCGCTTAAACGACGTCCCCAGGTCAGTCGATCTGGTGTGCCGATCTTGCTATTGGTTCCGGGTCGCGTGGCCTGTACGGGCACGGTCTTGATCCGGT
GGCCCACGATCTTGTGGCTCGTCATGATTTCCAGCTGCCGTCAGGTACACTCAGCACAGTCCCGCTTCGCCGTTCGATCAGCCCGACTCCGCTTCCGACT
CACTACTGTCGCCTGCCACGTGGATCGCGCGTACTGTTCGCGTAGGGGCTGACggtgtggctgctgtcggtgctcTCGTCCGGGTCTTGACCGATCCATA
GCCGCTCTTGCTCCGACGCGCCTTCGCACGCTGTCGAGATCGAAGCATTTCTTCCAAGGTATCGGCATCTGGGATTCGCAGCAGGGTGAGGTGGTCGGCG
AGGTCACGATCGTCCACCGTCTCGAtgaagtggtggacgtgTTCGCGTCGAGTCTCTGGAGATCCATATTTCACTTGGAGACGTGTACGGAGCCCAGCTA
AGTTGAGACGATGCAAATATTCCAGCGGCGACTCGTCTGATCACTTCCGCGCGTGGTAGTCCTTTCTCGCGACAGGTACGCCACAGCCGCAGTACTGCAT
CTGGAAACTCAACAGCAGATCCTTCCAGTCATGCGGCTCAACTGTCGGAACCAATCCCGCGCCGGCCCAGTAAGAATATCACCGAAGACCAGGCACTATT
CTCATCATCAGGTGCTTGATCTCGGATGAACGCTGATTTCACTTTGCCGATCCAGGACCGGGCTCGATCTTCGTCGCCCTCCTTTCCAGTGAACTCCTTC
AGTTCGGACATTGCCGATACGCAGATGCGGGGGGCGGCTGTCGATCTGCCGGTCTGTGAAGTagctgtcgtcgccactGCTGTGTGAGTAGTCGTGGTAA
GATCGAGGTCGTCTGGATCGTATTCCCATGTAGAGGAGTGGTGATTTGGCGATCCAACCGACTCCATCCCacgtcttgatctccagtcggTCACGTGGGC
GGGGGGTGGACTGTTGTTCCTTCAGGAAGCGTCCAATCGCAGCTTGAAAGTACGACGCCAGCCTCTCTGACGAGTGGCGAGTCGGGTTCACTGCTG