Description :
From Genome Similarity Track
Location :
Scaffold_306:42- 4114
Sequence
4072 bases(100 bases per row)
GGACCTCAATCCGATGATTCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCTGGCGGGAGCTCCACCTC
TCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCGAAATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGGCTAGGGATA
CCGTCCTTCGCCAACCATCGTTTGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTC
CCTGGATTACGGGAGGCACCCATTTCTCGGCCCGAGTGACGCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGGTCCCAGGTTTCTGCGGG
CTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACAGCCGCCGTCCGCTGAGCTGGATCCGCATCTCATCAGGGAAACAA
AGTGTCCCATCCGCCAGATCCAACCTCACTCCGGGTGGGACCATGGAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGA
GCCAGTATACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACT
CCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCAGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATC
TTGCCCCCTACCTTGGCTTGCCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGCGACTCCTCGGTTAGGCAGATCCATGGATCCAACATTC
CTCAGATCCACGGGATCTCTGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCCTTGGTAGGCTCCAACCATCGACCATGTTGGCGTTTCT
CCCAGTAACCACGCTGCCTCTCTCCTTTGTAGATCCAGGTTGAAGAGACTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACT
GACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAG
AACGCTCGGCTCGTACCGGATTCAAACCGGCGAGCGTCCTACTTTAACATCTTTTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACC
ATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTTGCCACAACCGCGACATACGTAGAAGCAATGATCTCCGGGATG
ACCTTTCTTGCCACACTTCTCACAGGCCAGATGTTTCCAACATCCAGACTCTGTGTGCTTCCGGGATCCGCACTGCGAGCACCTGATTTTCGCTGTCCCG
TACATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTTCGGTATCCCCCGATCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGGTGGGTGCAG
TGAGACAGACACGGCGGTAATCTTCGGGGTCAGAGTCCGAGCCGTCGGATCCCGATTCAGTTCCTGAGTCGGGCGATGTGACTTGGTGGACACGTCGAGC
TGGAGCCGTGGGCGTCGGAGCTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGTAGTACTTCT
TCAAGCTCATCTGCGTCTGGAAGGCGTAGCAGGGTCAGTCTGTCGGCCAGATCCTCATCTCCCAACGTCTCGATGAAATGATCCACATGATCCCGTAGTA
CCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGC
ATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGC
TGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTT
TGCTGATCCACGTTCTCGCTCGGTATTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGTTATGGCTGAGATCCGTACCCTCTGGATCATGAACGA
TCCACCCGCCCCGGCAGCGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCCGGGTCGAACTCATCATGGGAGTTGTCCCCCTCC
ACTGACTCCATCTCCACGTCTCGTGCTTCAATTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGGCTCGTCG
TAGCTTCGAAGTGTCGTTTCAGGGTGCCGAGGAACTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGTCAGGATCCGTGAGGCGACTACCTTGA
GCCTGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTTGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGTCT
CCGCGTTCACAGGGACTTCCTGTCCCCGGATCCTCGCCCGCTCTTCCAGCATGGATGCCCCGGAGGGTATTAAAGTCATGCATCGTGGTTCGAACGACGT
GTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCATAGTGCGCGACCTTTCCTCCGGTG
ATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGTGGATACTATGAGATCCTAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACGCCAGCTACGATGC
CCGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGACGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCG
TGGATTCAGGATCTGCATGACAGGATCGTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTG
GATCTAGCTTGGCCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGAGGTTG
GGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCAAG
ATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCA
AAACTCCATCGATCCGCGGGTCTTGTTTCATTGAACAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCACAATCTTCACTTGAGCAT
CTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTAGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGAT
CCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGG
CGGAATCTTGCTCTCTTGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGTAATATC
TTCACTCTGCGTCCGTGGTTGGTTCTGGATCCAAAGCGAATATTCAAGCTTATGGATCCGAGGCCTAGATCGTAGATCTGGCCGTAGGGTTGCCTTGCGG
GTGTGCTCCCTTGCCTTTGCGTTTTCCTGTGCGCTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG