Description :
From Genome Similarity Track
Location :
Scaffold_1888:42- 3544
Sequence
3502 bases(100 bases per row)
TTCACTCCTTCCTCATAATCCACCCTTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCCAACCCA
CACCCTTCCTGTGGGTCCTTCTTCATTCTCCCATCGACATGACCAACTCACATCCATGGATTCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGA
ATATGTTACGATTTGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTGCGTCATATCCACGCCA
ATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTAACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCCTCGAGATCC
ACATTTCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCTACCCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGATCCGGATATTCTTTGA
CCAACTTCAGCTTGGATACGTGGAACAAGCGATATTCGGTACCTTCCCTTTTAGCTTTACCGCATGTTCTCCTATCTTTTCGCTCACCCGGAACGGTCCA
TGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCCTTCACCCGATCTAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTT
CGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGCCGTGCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTGATATCGCCATCGT
CTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCTGCTTCTAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGGGGGTCACC
CCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGCTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTAGACGTACATCTTGAGTGCT
CTTGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTC
GAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGT
TTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGATAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTTGGGCAA
CAAGGGGATATGATCCATGGCTTATGATTTTGGAAAGGGTAGGTCGCTTGAATATTCCCCAGGTGACTCCCCTTCGATTGTGGGGGCGTGCCTTTGTCTC
TCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAGCATTCCCAGATCCGTTGGTAGGTCCGACCAATACC
CTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGCTGTAGGACATCCTCTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTG
ACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTCATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGT
CTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCACTCAATGCGGATCCCCTTCACAAATGT
TTCCTCGAGAATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGTCATCACCTGGACTGTCCTTTTCCCGGGTCCAACTACCACCACTTCG
TCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTTGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCAGCAC
TGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTACCGTAACAGTGTTAGGGCCGGGGCCTT
GCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTGTAGATCCAAACTTAGAA
GGAGCCCGTTATACTCCGCTTCTTGACGGTGAGGCCTTCCGCGTAAGTAGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTG
TATGCTTCTCCTCCTCGTCTTACGCGAGCGGATCCATCGAAACTTAGGACGTGCAGATCCTCATCCACCTGTACCGTGGGGATCGGGATCTGGATCCGGC
GTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCC
TTTCAATCATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGC
GTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTC
CGTATTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCATCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTC
ACTGGCATAAACTATCACCGTAGGTTGGCGTTCCGGGTCGAAATGACGGAGGATGGGTGTGGTCGCGATCCTGTTCCTCAGTTCCACGAACGCGTGTTGA
GCTCGGATCCACCGAGGTTCCACCTATTCCGCGTTCTGATCCGTCGTCTCTATCCAGATTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCCTCT
GTTTTAGGTCCTCTTCTGACGTCGTACCACTTGGATCTCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTGATCTGGACAGCTGGAGT
GGTCATCGCAGCAAAGTCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAG
AAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGC
CTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCA
CAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGAATCCCCTGGCTCTCCTGCCTCA
AA