Description :
From Genome Similarity Track
Location :
Scaffold_2594:42- 2878
Sequence
2836 bases(100 bases per row)
GGGGCGATCCTAGTCAGCGCCTCATACATCTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCACAGATTTTGTTCTTCCCATTTCGAACTCTTCACAAT
TCTCCAGCTTCCAGGGCGAGAGTAAAGGCTGCCCACTGTCCCCAAACGTCCTGTAACCCGGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCGAGTCA
GGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCAAGTATCTCTTTCTCCACCGCTCCGTAGTTCAATTCATT
CGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATT
ACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAG
ATTCTGCCTGTTCCATGTTCTGATTTGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGAGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTC
TGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGGGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAA
TCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCC
GTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCAAATCCCTCCTTAGAAACTCGATGGCCCAAGTACTCCACCTT
GCGCATCCCCCAATAGCTCTTTACCACACAAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGAT
TCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCG
TATGGCCTTCCCCAGACCCACCTGTTCCGAACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAAGCGTTGGTAGATCTGGGGTGCGTTCTT
CAATCCGACTGGCATCCGGTTCCACTCGAACAGGCCAAACGGGGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCA
CTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAAGAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGT
TAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATTCCCACGGGGACGTCGAGAAACTGATGAT
CTTGGCTTGCAGCAGGCTCTTCATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATAGGTTTCGCGTCGCCGACA
TCGATGTCACATTTGACTTTGCGGGCAGCGGGGCGGTAACGCATTAACCTTAACCAATCAGCAGATGTCAGCTCTCCCAGATTTTCTGACGCAGACGATC
CACTTCAGCAGGTTCATTCTCCCCCGGATCCACTTGGATATCGTCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCAGGATCACCGCCATGCCTTCT
CCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACGGCGGCCCTC
TCTCGCCTGGCAGTCCTTCTATCTTCGAGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGA
CAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGAATCAGCGGGATCCGGCTGC
TCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAAGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACCTCCATTGCTT
GGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCTACCAAAGGGGCCAGTTGGTCCCACCGGGAGCTCCACC
TCTCCGAGAGATTCGATTTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCGGTAACGACGAGATCCCACTGACACATATCCAGGCCGCCTAGGAG
ATACCGTCCTTCGCCAACCATCGCCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTAGAGGTATTGTGATTGACCT
GGTCCTTGGATTACTGTAGGCACCCATTTCACGCCCCGAGTGACCCACAGTCTTTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCTCAGGTCTCTC
CGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCGCCGTACAACGGTCACCGACCGCTGAGCTGGATCCGCATCTCGTCAGGGAA
ACAAAGTGTCCCATCTGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATA
TTAAACCAGTATACCAAACAACCTGCCAGCGTGATC