Description :
From Genome Similarity Track
Location :
Scaffold_3799:42- 2826
Sequence
2784 bases(100 bases per row)
CGAGTTTTCCGTCTCAAGCTGAAGGCGATGCTGGATTTAATCGTCAATGGCGAGATCTTCGGTAAAGTGAAAGGGCGTGTGTACGTGGTCGAATTTCAGA
AGCGTGGCCTGCCCCACGCTCACATGCTCTGGATCATGGACGACGAGTACAAGGCCAGGACGCCAGAAGAGATCGACCGGATTGTGTGCGCGGAAATTCC
TGATCCAAACGACAAAGAGCTCTACGAGATCGTCACGTCACACATGATTCATGGACCTTGCGGTCTATTGAACAAAAAGGCCCCTTGCACGACAGATGAT
GGCGTGTGCACGAAGAAGTTTCCCAAGGCGTTTGTCAGCGAAACTCAGGTTTCCACAGGTGGCTATCCGCACTATAGACGACGCGACAATGGTCGAACAA
TCCTGAAGGGTGTGCATCTCCTCGACAATCGCTTCGTCGTCCCGTATAACAAGTACCTGCTCAAGACCTTCAACTGCCACATCAACGTCGAGATATGCTC
TTCGGTCCACTCTGTCAAGTATCTGTACAAGTATGTGTACAAAGGGCACGATCGTATTCAAGCTCGCGTGACAACCGAGGAGGATGGCACTCAAGTCCGA
GACGAACCTCAACGCTACCTTGATGCTCGCTATGTGTCTGCATCTGAGGCGTATTGGCGAATTCACGAGATGAGTCTGCAGAAGATGTATCCAAGTGTGA
CTACTCTTGCGGTCCACGACGAGAACCAGCAGCCGGTCACGTACAGAGAAGACCTGACTGTTGAAGAAGCCCTCGAGCGTGCTAAGGACACGACCCTGAT
CGGGTGGTTGAGCTATAACGCGGAGCATCCGGAAGACCAGCTCGCCAAGCGCACTCTCTACTGTGATTTTCCGTCTGTCTACATGTGGGATCTCAAGACA
CGCAGGTGGCACCTGCGCAAGAAAATGGTGGTGATTGGACGAGTCCACTTCGTGAGTCCCAGCGACACCAACCACTACTACTTGCGGCTATTGTTGCATC
ACATACCCGGTGCAACATGCTTCAAGGACCTGCGCACGGTGGATGGCGAAGTGTGTGAGACGTACCAGCGCGCGGCGGTTCGGCTTGGGTTGCTGGAGAC
GGATGGGGAGTTTGACAACGACATGCGGTTGGCTGCGTCGTCGGCGGCACCTCGCCAAATCCGAGAGCTATTTGTGATGCTTCTCATGTTTTGTGAGATA
TCCGAGCCCGATGTTCTCTTCGAACGCTATATCGCGGACATGGCGGAAGATTTCATGCGGGCTGCTCAGGTCGATGAAGTCAGCATTGCTATCCGCCAAC
AGGTATTGAGTGCGTTGGAATCCATCCTCTACCACAACGGCTCAAGTCTCGCCATGTTCCCATCCTTACCGCACGACGTCGAGCTTCCACCAACTGACTC
CGAGTGGGGGCCAAGCCAGTCGAACGACGTTCTTCCCGACATATTTGAGGCTGAACGCTTGGGCTCGATGCTCAATGCCGAACAGCGAGCTCTTTATGAC
GCAGTCTTGGCGGCGGTTGGCAGCATGAACGACCCGCGGCAGTTGCTGTTGCCAAAAGTCTTCTTCATCGATGGTCCCGGTGGCTCCGGCAAGACATTCC
TGTACTCGGCACTCTTGGCGCAGATGAAGGCGTCCCGTCTACATGTCATGGCGACTGCAACAAGCGGAATTGCGGCTTTGCTGTTGGACGGAGGAAGAAC
TATGCACTCCACGTTCAAGATTCCAATCCCAGCTAATCACCTCTCGACTTGCCACATCGCCCCGAACTCAAGGATTGGTCGTCAAATAGCGACAGCGAGT
CTGATCATCATTGACGAAGCTCCTATGATGCACCGACACACGTATGAGGCTATCAACAGGACGCTTCAGGACATCATGAAGGAGCAAGATCCCAGATTGG
AGCATGTGCCATTTGGAGGGAAGGTCATCGTTATGGGAGGTGACTTCCGCCAAATGCTCCCGGTGATTCCGAAAGGATCTCGATCAGCTGTTGTCGCTGC
TTCTCTCAATCGCAGCAAACTGTGGCGCCACTTTCAAGTTTTCAAGCTCAAGACAAATGTCCGTGTGTCCGTGGAACACAGGGAGTGGAGTGCGTTTTTG
CTGGCAGTTGGTGAGGGGCGTGTCGACCCTGATGTTCCACTGCCACCTGAAGTCCGGCGCTCCGACTCACTCGAGGGACTCATTCAGGAAATCTATGGTG
ATTTTGCTGAAGGAGCTGTCTCGATCACGGCGAAGACAATCTTGACGCATTTGAACGAAGACGTTGCTCGCGTGAACGACGTCGTGTTGGATAAATTCCC
CGGTGATGTCATGGAGTACCGCAGTGCCGACGTCATCCCGCCAGGCGAGGTGGACAATGCATCACTCTACCCGACGGAGTTCCTAAACTCGATTGACATG
GCGTCCATGCCTCTGCACAAGCTTCGACTGAAAATCGGTTGCGTCGTGATGCTTCTCCGAAACCTGAAGACTACGATGGGGCTGTGCAACGGGACACGCT
TGCGAATCGACGCCTTCTTTCCAACGATGCTTCAGGTGACAATCGTCAGCCAAGGGGCGCACTTCGGGGCGACCCATTTACTCCCGCGGATCGCTGTATA
TCCGTCGCAAACGAATCTGCCTTTCAGCTTCAAGCGCCTCCAGCTTCCTGTCCGGCTTGCGTTTGCCATGACGGTGAACAAAGCCCAGGGTCAGACATTG
GACGCTGTTGGCCTCTACCTGCCTAACGACCTCTTCGCGCATGGTCAACTGTACGTGGCTCTATCACGAACACGTCTGGGGCCG