Description :
From Genome Similarity Track
Location :
Scaffold_3444:42- 2387
Sequence
2345 bases(100 bases per row)
ACAACAAAGTGGAGGAATGGATGGTCAAACCGGATGAATATTGAAAACCTTCGTTCTTAATTGCGGTGTATATTTGATCCACACGAATTATCATACCCCA
ATGTTTCCAGCTGTTGACGGGGTCACACAGCACCCTTCGCTACACGAAGTTATCTTTCCGAAAGTATACAAACTCTTCAGTGGACGGCAGTTCACAGGTC
CCCTCTTTATTTAAGAGAGCGTAAATAAGGTAGATGTTAAACTGAGTATATTTATAAGTAGGTTAAGTTTGAATTTAATACAAAACTATAAGTTACCTAT
AGAAAAGCAATGTCGTTTGCCCAATGTTAGCTCTGAACGACCTTGGTACCCTGTCTCAAATATCCCGGAGTATGACGTGTCATACACCGAAGTGTGAAGT
GTCACACTTCATGTAACCAGGGTGCACTTAGGGCTCCGTACCCCGTTACATACCTCCCCCACTTAGGGTCGGGTTTCCGACCTGTCAGAATGAAGAGGTG
TTCGTCACAAACTCCCATTCTCAAAGTCGAAAACCATCGACTTGGGCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCAACCTG
TGCGCTCTTCGTCTAGGTCTCCAATTCGACGGTTATCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCTGCCGGTAAGGCG
CAAGCCAAGAGCACTAAGGACCACGGCAAAGGCTTGGCACTCAAGGAGGTCTCTGAGGCGATCGGTTCCTCGGGTGACGCGGCTGTGGGCAAGCGAGCAA
GCAAGCGCCGCAGTCCGTCGCCCTCGTTCCCAGACAATCGTCCGAGCCCTCGGTTCGTGGAACGTGAGTTCAACTCTGGCAGTGAGGACGATGCCGAGTC
CGAGAGCACGCACGATGCTCCTGCGGGCTCTATGGGAGCCAACAGCCCATTGCCCAGTGAGCACAAGAATGACAGCGTGCAGTCGCTCGCTATTGATCAA
GGTGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGCGCTCCCAAAGCCGGCGGCGATGAGGAAGAGAGTATTCGCA
AACGTGTCTCGCTTGCCGAGGGTCTTGCGCGTCCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACAGCCTTTAAGTCTCCACTCGC
GAGGAGAAGGAGACTCGACACTCCTATCAGAGTATCTTCGACTCCTCGGAAGAAGAGGAGGAGAAGGAGGAAGAAGAGGAGGATGAGGGTGCTCACGTTG
AGCCCCGGATAGTCTCAAATGACATCGACCAGCAGCAGGAGGAATTTTAAGCTACCCAGCGTGTGCGTAGGGGTTCGGTGGTGGCATCCGTCAGCCAGGG
AGCTGCCATCAACGCAGGAGGGTATTGGCCTCCCGAGGAAAGCTCTGGTGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGC
CACACTTCTAGGGGAATCTACGAACGTGCCCTTGTTCAGAAAGAACAGTTGTTCGTTGACAACATGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACC
GCATCCCTCTCAAGGACTTCACGACTTGTCGTAAGAAGCCCGGGACCCGGGGTGGTCTTTATCCTCTTTGGGGATACTCCTGCGTTTGCCCGAGAACTGT
CCCACGTGGAGTACTTGTGAGGACATGTTCTGGGCATGGGTGGAGTCTCTTAAGTACTCACCCACGGAGTTACGGGAACTCTATGAAGATCAGCTGTTGT
CCCGCATCCTGGCCCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGCATGCTGCCAAGTGACATCCTGAAGCGCGCGGCTTCTAGCGC
TCACGATGAGCGCGGGTACGGAATGTATTCATCGTCCGTACCCTGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGGCGCCGCTTCTGCTCCCAGA
TTGCGACAGCCTTCAAGCAGTCAATTAGGAGCCGTTCAATGGGCTCTCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTT
CCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTA
CTCGGCGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCTT
GAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAG