Description :
From Genome Similarity Track
Location :
Scaffold_3123:42- 2343
Sequence
2301 bases(100 bases per row)
GGAATCAGTGTCACTTCACCTGCATCTCACGGGCCACGCCCCAGAGTGCCTTGCGCTGCAGTTGGACCCCGACCCTCGGGGTCACGCAGCGGTAGGTCAT
CGACCAGATTCATACCACTCAGTGGATTACGCGCACTCCGCGCTCGTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCCCGCGG
ATAACGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCG
TGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCAACT
TCCAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTATC
GAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACT
TCCAGTGCCTCAGCATACAGCTGACCCCCTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTC
ACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACACTCCTTCTCTTAAGAGAGACTCAGCTCTCTTCGGGCTGAAACCCGTTTGTCCTCTAACTCC
TTCCAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGA
GCCTCGCACTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAA
GCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCCCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAA
GTTGTGCTTCGGCATTTTATGTGCCCCCATCCTCCGCCCTCTTTCAAAGAGTTTAGGGTGTAACACGGAAAAACTTCCGTTTCCAACTGCGCTCAACACG
CAGTCCCTCCCATGTAACACGCTCACGCTGAACCATTTCCGGAAGAGGGTCCGCCGCCCCATTCGCGCGCATAAGAGATTCTCAACTCTGGAACATATTT
CCATATATCTCTTCCTACCCTGTCGGGTAGCAAAGAAACTTCGACCGGATACGGTACGCCTGATAGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGC
TTATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTTCAAGCCTGGAGATAGCCAGCGCCACGCGCT
GATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTTCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCC
CACCATGAGCGGTTTCAGTCTCATAGACGCTTCACGCGTCATCGACGCCGCCTCCGTTGCGGCGCTCATCTTGTCTTGGACGTGCTCCAAGAGCGCGTTC
TCGTAGCGTGAGAATGATTCCAGCCTGGCGGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAATGACATAAGCTTAG
TAAGCGCGTCCTGCTGCGGCCGAGGGCAAATTCACGAACACGGGGGGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGGAGCGGGATTGACTAC
AACTGCTACCAAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCAAAGGACAC
TTACAGCCCAAGACCAGGGCTCAAAGTTAATACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGG
TAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAGC
TTATGTACTGAGCGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAATCCCGTTACATTTTGCGTATCGTGTTATTGTTGCG
T