Description :
From Genome Similarity Track
Location :
Scaffold_28:42- 2160
Sequence
2118 bases(100 bases per row)
ACAAAGGCATTTCTGATGAAGACGATGGACAACACGCACGTTCGGCTGGTCAAAAATCTCGTCACGTCTTACGACATCTTCACCTTCATCTGCGAGAAGT
ACGAGGGTGCTGCCTTCCACGGCGACCCCTACTTCATCCAGCACTACCTGATGGAGATCAAGTACGAGGAGGGCTCTGATCTCACATAGTTCTTCCTTAA
GCTTGAGAACGCGATGAAAGCCGCGTCGGAAGCCACCGAATCGGTGATGACGGAGGGACAGAAGTCAATCTAACTGTTCCACTCCATGCCCAAGTCGTGG
AAGGATGATCTCCGCGTTTGGAAGGGCCAACGGAAGTACATTCCATATGAGGACCTCAAGCAGAGTATTGAGGGCAAGGTGCGCGACCTCCAAGCCCAAG
AGCGCTACACATTGGCGAAGGGCACACCGAAGACGACAGCGACCAAGAGCGACCGTGCCCTGGTTGCGGTTGGACCTACAAGTACTTCGCCCACCCATGG
CAACAGCTACAACAATACCTGCTCGTACTGCGACCGCCCGCGCCACGCTATCCGTCACTGCAGGAGCCTACAGAAGGACCTGCGGACTGGACACGTGAAG
GCCGGTACTGTACTGCCTGCGAACGTTGTGTTCAAAGGCAACTCAAAGCGTGAGTACCCGAAGAACAAGGGCAAGAACAAGCGCAATGGAAACGGTGCTG
GTGGTAACTACAACGGCAATCGTGGCAAGGATCGACAGCGCCAAAACCGCCAAGAAAGCTCTGATTATGATGACTACCGTCGGAGCAAGTCCCGCGAACG
CAAACGCCGCCAGGACGACTCGGACGATGATGATGAAGCCGATGGCAACCGTCGTAAGGTATTTCGCCAAGAACGCCGCGAGTCCGGCCTGATTGCTGTA
GCCACCGCCATCAACCCGCCTCTGAGTCTCACAGCTCAAGCCAACGTTGATATGGACACCACGTGGACCATTGATTCTGGATGTACGCGTCATGTGACGC
ATGAAGCCCAGTGGTTCTCGAACATCTCTGCCAGTGGTAGTTCCATCACCGTCGGCGGAAAGAATCAAATCCCGATTGAGGGTATTGGACGCGTTGAGCT
GGAAGTCATCGACTCCAAAGGCAACATGATGACGCTCATCCTCCACGGCGTCGTCTACGCCCCACAGCTGCACTTCAGCTTACTCTCAGTCTCGGCTGCC
GTGAAGCACAACTTTCGCTTCAGTTTCGATCGAAAGCAGTGTGCCATGCAGACTGATGAACACTTCAGTATCAAGGTGCCAATGGCGACGAACACGGATC
TGTATCAGTTCCAGGCCAAACCTGCGGTGATTGCATCGGCACTCATTGCCACGTCGGGTAAGCAACGCTCTCTTCTGCTTTTACACAAACGTCTTGGGCA
TCCTAACGTTCGCATCTTGCATGATCTATCTAGGAGCCAAGCCATCCGTGAACTCGAACGCACTGCGTCTGTAAACCCGAAGGAGCCATTCTTCTGTACG
GCATGCACGCTAGCGAAGTTTCACCGCTCGCCCTTCTATTCGAATAGAGTAGTTGACCATGCCACAGCACCATTGGAAAAGGTTCATACAGACATTTGTG
GTCCTTTACCTGTGCCTAGCCTTACTGGTTGCCGTTACTTCGTGATCTTTATCGATGATTATTCCCGATTCATGTTCACATATCCGATAAAAAACCGGAG
TCGTCTCTATGAGTGCTATGAAGACTTCAGAAAGAAAGCCTTGAACATCTTTAGACACGACATCAGTGTGCTTGAGTGGCGTCCGTGTGCTATCGAAGAA
CACGACATCCAGGTTCTCCAGGCAGATAATGCCAAGGAATACGAAAAGCTTGGATGTGAAATCTTCCGGAAGTACGGCACACACGGACAATTCACAAACG
CGTACACTCCGCAACAGAACGGAGTTGCGAAACGTCGCATGAGAACTATCATGGAACGGGTACGGGCCCTACTGCTTGACGGTAAACTTCCGAAGCAACT
CTGGGGAGAGTGTGTCTGCCATGTTACGACCTTGATCAACATGACCCCTAGCCCAAAGACTAACGGCCGTACACCCTATGAGCTCTGGTACAACCGGATT
CCATCCATGCAGTATGTC