Description :
From Genome Similarity Track
Location :
Scaffold_2645:42- 2042
Sequence
2000 bases(100 bases per row)
TCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGAAGGTGGATCTAGTAGCC
ACGGCTAACGAGGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTTCGAGTTCGGATCCAAGGAGGGAGGATTCCGCCTGGAGGGACCTGGAT
CCAGGGTATAGGGTTGATGGATACAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGATATGATGTTGGTTGATGGGAGAGCTCA
GATCGACGACGAGTGCGAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGA
TCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGAAAATAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAACAAGTAAAAGACATAGA
AGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGTCCTCAATTTGCACAGTAACACGCAAGTGCCTTCCTCCCCTCAAGAACCGGAACTACA
TTGGCCGTACGAGCTAGAAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACAGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTT
CCTTTACACGTGCAGATCCGACAGGTTAACCGTATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCA
AGTATGACGTAAAGGAAACGCAAAGGCAAGGGACACACCCGAGAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATT
CGTTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCGCCACT
GGAACTCTTCGGAGGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGAAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCC
TCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGTTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCT
TTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGC
TGCTGAATGAAACAAGATCCGTAGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCTGGATCTAAAGGAGAAACCTCTCTATCC
TCCCCACGACTCCTCGGGGACCCCTGCGGATCTTGACCCAAGTCAAGATCCGCTAACGAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGAT
TCACCGCTTAAGTCAGCACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAG
CTCCAGAGTCGGAAGAAGCCCAAGCTGGATCTAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTTCTGCA
TCAAGATCACGTCATGCGGATCCGGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAGCGAAAACGGCGAACAAGTTGGTGGCAGTC
AAAGATCTATTACGTTTGCTTACCGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGAATATCTTCGAGCTAGACTTGCATCTCATAGTGTCCGCGA
CGCGGGACCTCTTTGCCAGAGTTAAGCCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGCCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAA