Description :
From Genome Similarity Track
Location :
Scaffold_413:42- 1181
Transcript NameFunction/comments

Sequence
1139 bases(100 bases per row)
CAGCGCTTGAGTAGTGAGAACCCGACCTCAATTGGATTGAGATCGGGCGAGTAGGGAGGTAGAAAAAACAGCAATGCTCCTGTTTCATGAATCATCTCCT
GGAGTTCCTTGTACATGTGGATATTGGCGTTGTCCAGCACCATAATCGATCGAGGCAGCGGTCACGGGTCGAGAAACGGGAGAATTTTAGTCTTGAAAAC
CTCATGAAAACTAGCACGCGTAAAGGTCCTCTCCACGTTGCCCCACGCAAAAAAAGCCTTGGACGTCCATCGCAGCCAGAATTGAAACCCTCTTGTCGCG
ACTGAAAGGGAGGGTTACATGGGCAGGGGTGTTTCTGGCAGACCAGCCATACTGTGACGGGCCTCCGTCACACAGGTGCCATCGCGCATGATGGCCAACC
AGATCTCAGTATAGTTTAATTGGCTGGGACGGTCTCGAGTGTCGAGACCGTCTCGTCAATCAATCAAACAGAGTTCATTCTACCACACCTAACGGCCTTA
GCCCGTTACACATACCGACACAGCACAGATCTACAAAGCAACAGTATAGGCAACAATTTGAGTTAGATCTGCAGTGACATCGTTAAAATTGTCAAACTTA
CCTCCCATCCTTTGAAGTCTCGTCGATGAGGACGAGCTGGCCGGGCCCACTGTAAAATGGAGCGAGTCGGCCAACGTACTCTCGTCTTTCGCGCGGCACG
CTCTCTCTTGCACGACTTTTCGCGTTAGTTTCAAGTCGAAACGTAGAACGCGGCATATCGTCGAGTCGGAAACGCATATCGAGTCCTTGTATCGCACACG
TAGCTCGTGGCGAAGTTCCTCGAAGTAGAAGCACGGATGTTCCTTGACATATTGCCCCACAAAGGCACATACATCACGAGGCCATCGTGACGTCTTCGCA
CGGACCTCAGCCTTAAGCACATTATCTGTTGTGTGGAACTGTTTGTACCATCGATTTAGACTACGTTCAGAGAAGCCTAGCACGCTAGCTACAGTGGCAG
TGTCAATCGAGTAGACGTAGATGAGCACGATGCCTCTCCAACGCATGTCAGTTGAGTAGGTCATCTTAAATCTCGCTTTTGACGAAAGCTCTGAATGCCG
GGCGAGCTCCAGCCATTCAGACATTGTGCTGCTCAAAGC