Description :
From Genome Similarity Track
Location :
Scaffold_671:42- 1155
Sequence
1113 bases(100 bases per row)
TGCTGTATCCCCATCTTCACCGCATAGTACACACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTCGAGCAGGCAAGCTCTGCAGTGCTTTGT
CCGAAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGTGGCTTGAACTGC
GATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTTGACAATGCGTCGGCTAAG
ATGTTTGACTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAGCCATCTCGCCATTCTTTGCGATAGGTGAGGCGTCTTTACAG
CTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCGAACTGCTTTTCACCGAGCAAATAGACTCGAAACTTTGCCAATGCATATTTCATGGCCAATAGTTC
CTTGTCGTGGACTGGATAGTTCCTTTCGGCGGGCCTGAGTTGTCGTGACTGATACGATACAACTCTTTCTTTGCCCTCATCATCGTGTTGCATCAGTGCA
CACCCGATGGCATAATCGCTCGCATCGCAGACTACATGGAACGGCTTCTCATGGTCTGCGAGAGCTAGGACAGGAGCTTCTCTTAAGCTCTTCTTTACTT
CGGCAAACGCTGCCTGATGTTCCTCTGACCATTCCCACTCATTTTCTTTCTTCAAAAGACTCGTGAGGGGTTGCACTAACGCTGCGTAGTTGCGCGTGTA
TTTGTGCAAATAGTTGGCCAAACCCAGCCACTGACGTAGCTGTTTGACGTTCTGAGGAATAGACCAATCGTCAATAGACTTGACCTTTTCAGGATCGACC
CGAACGCCATTCTCGCCAACAAAGCAACCGAGTACAGGGATCTCGGGGGCGAAGAAGATGCATTTCTTCAAGTTAGCGTACAGTTTGTTCTCACGCATAA
CTTGAAAGACTTGACGAAGATGTCCAAGATGACATCGACATCTTTCTTCCCTTCCGAGGCCTTGCTGTGAACGAATATGTCGTCAAAGTACTCGGTGCAA
ACTCTCTCATGGA