Description :
From Genome Similarity Track
Location :
Scaffold_588:4199- 7404
Sequence
3205 bases(100 bases per row)
CAGGTATGCCTTAAATCGCCTGACATAGAGCGTCGGGTGCAAACGCATAGTGGTAGGTATGTCTAGCGTGTAAGCGTCTCCATGTGTCTTAACAACCCGA
AAGGGATCAATATATCTTGGCGGTAAAATATTAGCGCCTAAGTTCGTCCCAGATGTGTCTGGTAATCAGTTTGTTGATAACAAGACTCTGTCACCTTCTT
TAAACATCAACTTGTTCTTTTGACGTCTCTTGTCAGCGTTCTCGTTTTGTGTATCCACTGATTTTTGAAGGGGGTCACGTACAAAACGCGTGATGCCTTG
TTGATTTAATATGAATTCGGTCACAAAAGCCAAACTTACAGGTGAAATGGTATTTTAGGAGCAAAAGTAGCGACGAGAGACGCCATAGGATGCATCGCGT
CCGGACTAGACATGTCATTCGCCACGAAATTAACAGCATAAGTTGCATCGGCAGCAACCTTATCTTCAACATAATCAATCATCAAATGTTTTGGCGTAAT
GCCATAGGCAGATACCCCCCCCCCCACACCAAGCTTAAGAACCGGGTTTTCTGAAGCTGAAAGATCAAGAAGCGCTGGAACGCGAGGGTGCCTCGCTTTG
TTCAAGAAAAATGGCGTCGATCCTGTTAACGCATGAACTGCATTGTTGATTGCAAATTCAGCGAGTTGGATAAATGAACTCCACGACGTAAATGGTGACG
CATAACTGTGGAGGACATCTTTAAGCATTCAGTTCACGCGCTCCGTTGGCCCATCCATCTCTGGATGGGCTACCGTAGACATAAGCAATCGCGATTGCGT
GCCCATAGGTGAAACAACTCAGCCCAAAAAGCCGATGTGACCCGCGTTTCACGTCGAATCTAGCCCGAAATGGATTCTACAAAGCTGTGGTGCCTGAATA
TAAGATCGAGGAAGATCTTCGCGGTCGTATCCGCCGTAACGTGCGTGGAGACTGGAGCAAAATGCACCATTTTGCCAAATCGATCCACAAGAACCAGTAC
GCCCGTGTGTTTCTGTTTGTCCGGTGGAAGGCCAAAGATGAAATCCATGCTGACTGAACGCCAGGCTTCCGTGACAATCGGAAGAGGTCGCATGGGGCTT
GTAAGGACGGTGTAGGCTTCGGAAGCTGGCATTTTCACAAGAACGTACCCATTTATGGATGTACTTGTACATATGCGGCCAAAAAAACACGAGGAACGGC
CGCGAACGTCTTTTGGCGACCCTGATGATCACCAGCTGGAGTGTCATGAAATTCATGCACCAATCATGCTCAGAGGTTTTCATCAGCAGGGATGACGACG
CGCGGTGGGTCAAAGACGTCCATCATATACGTCGGCAGCGGACCATTGACCGCGTAACGCTTGATGTTGTCGCGCGTTGGTTTCGTCAAATTTGCGAGTG
ATAACTGACTAGGGTGTCGAAGGTATTCAATACTTCCCGTGTAGAAATAATCAGTCGCATATGACTGAGAAATATGAGTCCGAATTGACAACACATGTGT
AGAAATCATTGCGTCGAGCCTCAGCTCAGCACAGCGTAAACAAATTTCATCGTCTTCGTCGTCGGCACGTCCTGGCTGATACCCATGTCAAGTCGAGGAT
CATAATCGGTCCGTCGAGAAAGCGCATCAGTAAGAATGTTATTCTTTCCGGGCTTTTAAAAGACCACGAAATTATATATTTTGAGAAATATAACAACCAA
CGTGCCATACGCTGGGACAAGTGGGAAGTCTTGACGGTGGTGCGCAATGATGCGTGATCTGTATAGACCGAAAACACCTTATCGCTAAGCAACTATACTA
TGAACTTGATCAGCGTGTAACGTATAGCCAAAGTTCCTTGTCATGTAACGGATAATTTCTTTCTGCAGATTTCATCTGTCGTTACTGAAAGCTCACGACC
CGCTTTCGACCCTCATCATCAAACTGCATGAAGGTACATCCGATTGCGAAATTACTAGCATCTCAGACGACGTAAAATGGCTTGGAGTCATCAGGCAACA
TCAGCACTGGTGCCCCAAAAAAGCTCTTTTTCACGGAGTCGAAGGCAGACTGATGTTCTGCCTTCCATGACCAAACTGCGTGTTTCTTCAGCAAAGTCGA
TAGTGGCTGAATTAGCTTGGCATAGTTCTTCGTATACTTATGCAAATAATTAACCAGGCCGAGCAATTGGCGTAGTTCCGTTTGGTTCTCGGGCGCAGGC
CAGGCACATATCGACGACACTTTCTCGGGATCTGCACGGACACCTTCCTTGATAACATAGCATCCGAGTACTGGAATCTTGGTAGCACATAAGATACACT
TCTTCAAATTTGCGTAGTATTTGTTCTCGCGCATAACTTGAAACAACTGTTTCAAGTGCCTAAGGTGAACCTCCGTAGCGCTGACCTATTGCTAACCGCG
GCTGTGAACAAATATATCTTCGAAGTAACTTGGTGCAAAATCGCGTAGCGGGCGAATCACATATTTCGCCATCCGGTTGAACGTGGCTGGAGTGTTCTTA
TGGCCTTTTGGCATGACTAGCCACTTCCAAAGCATCTCGCGTGGGGTGCTGACTGCAGTAAATGGAATATCACTGTCCTTCATGAGGATCTGATAAAACC
CATTCGTCAGATCGATAGCGCTAAAAATCTCGCTGCCGAACATGGTAATCAATATTATGTAATTGTGTGGAATCGGTGTTTGAGCCTAGATAGTGGCGTA
ATTCGATTGTTAAAAGCATGCACAATGCGCCAATAGCCGGTTGATTTCTTCACACAGAAATTCGGACTCGAATGTGGCGAGATACTTTCGCGAACATGGC
CTGCCTTACGGCGACTCTCAAAACATTCATCAAATCGCGATGTTTTAATCACGCGTTAACGGTCACTGCCGCATCACGCAATACTTCGGTCCTGGCACTA
GATCAATCTCGTGCCGCACTCCACGACAAGCTAGAAGATCAGCGAAAATTTTCTCCAGGAAGACATCGGCATCCTCGCGAGAGATATTGTAGACAGGGTT
GTCCGAAGCACGAAGGGCTTCCCAGGACTGTGCCGAGAAACGTTCTTTTCACGCTGATTTGGTCTCGACACTCTTCGGGCGAGCCTCCAGAACTTCTTCC
CTAGCTGCTTCGGCGGCTGAAACATTACACACTTGCTCAATGTCGCCGGCCTTGACGTCGTGAAGGAAATCGTTTTATGGAAGGCCTGATAGAGATATTA
GCTCC