Description :
From Genome Similarity Track
Location :
Scaffold_16:419832- 424027
Transcript NameFunction/comments
Phyra_76185AlNc14C12G1445
Phyra_94407anaphase-promoting complex subunit, putative
Phyra_76186anaphase-promoting complex subunit, putative
Phyra_76187predicted protein

Sequence
4195 bases(100 bases per row)
TCTCCTGGGGCGGGAGGCCCTTCCTGTGCTTGCTCACGACCTGCTGGCGCTTGTTGCGGTTGTTTTGGGCGACCTGCTGCAGCTTTTTCTGCTGTTGCTG
CTGTTGGATTTGCTTCTTGGTGGGGGCGTTGCCCATCTTCTTCTTGCCGACCGCTACACGCAGAACCGGTTGCGTCTTCTTCCGCTGCTGCTGCATCTTA
ACGACCGTGACCTGGTGCTGCTGCTTTTTCGGCTGCGGCGCCGTCTCCTCCGCCAGGTGCGTGAAGCGACTGGACAGCGGGACGGCTGACACGCCGATCA
CGCCGCGAGGGCCCTTCTTGCCCGGCTGCGGCTGCTGCTGGTTGTTGTTGATCTTGCGCTGGCCGCGGACGGACGCCCGCGGGGCTCCGGATCGCCGATG
CATTCTTGGAGTCTGAGCAGCTCTTTTGCTTTGTGAGCTTTCCATCGGATTCTTTCAGTTGCGTGAAGCCTTTATGTTGCGCTTAAAGTTTCACGCACCT
TTAACACCGCGCGCAACTTCGGCGAGTAGTTTAAAAAACCGACACCAAGGCTGGCATGGAGACGGAGCTGGCGGCCCAGGTGCAGCGCTATCTGGATGCG
TACGTGTACGAGAACGCGCGGTTCCTAGCAGAGCGACTCGTGGCGCAGGTAAACAACCGCTTGGATCGGATTTGAACGCACTGAAAGCTGCGATGCTGCT
GTTTTAAACGCAATAAGTATCTACGTCATTTTAACACTTTTTGACCATTTATCGCTGTTACACGCAGCGTCCGAGCGAGGAGAACGTTCTGCTGTTAGCC
ACGTGCTACTACCGCAATGGACAGGCAGCTCGGGCGTCGGCGGTGCTGAGTGGCGCCACACGACCGGATAATCGCTACTTGCTGGCTTGCTGCTGCTTCC
AGCAGGGACAACTGGTCGAGGCGGAGAACGCGCTGCTAGGAGGTGAAAACTGCCACGTCGATGATGCAGAGACAGTTGAGAACATACCTGCGGGAGCTGC
TGGGTTGTTTCTACTTGGAAAAGTGTGCAGGCGTGGAAACAGGAGACAGCAGGCTGTTGCCTGCTTCGTGAAGAGGTGAGACGATGTTTCGGTTGATTGA
TTTTGTGGCGAGTTTATTGATCTTTGTGTTTGTGTTTGCGTTGTGTTGTGTTGGCGACGGAGTTAGTTTGGAGGTGGATCCGTTCATGTGGTCGGCGTAC
GAGCAGCTTTGCGAGCTTGGAGCCAATCTCGAGGCCTCGAGATTTTTCGGCGCAGCAAGCACCGGATCGGCAAATGAAGTGGATTCCGAATTTTCACTTT
GCCCGGAGTTTAGCGATGCAAGTGTTAAAGGTGGACATCAATTTGGTGATGAGGAAGGACACTACCGCGAGGACAACAACCCAGAGGATCGATCCACGGA
CGGAACATTGGGAACACCGGAGACTCCACTTTGTTTTCGCCCTTATACGCCTAAGAGCATTTTGACCTCATCGTTGAGCGCTTCTCGACCTATGGGTTAT
AAAACACCAATTGTCAACAGCAATAACGGGAAAGGTATGCATACAGCGACAGCCGTGAAGAAGCCGCGAATTGCAGATGATATTGGTGCTCCTGTACGAC
ACAGGAAGGTTCATCGGCGACCTCTCGCAGACAGTGACGAAAAGAACCGAACCATTGCAAGGCTGTCATTCTCTGCTGCTGGCTTCGACGACTCTCCACT
GGTACGGAACCAATCAATATTGTACTTGAATGTAAACGTAGTGGGCTGACTCATTATATTTTATCTGCGCAGAATCCGTCGAAATTAGCATTAGGCTCTC
CCACGTCTCCACTCGTTACCAACAAGACTCCTGGCCCTTTCCATAGAGAAGGATCATCACGTAATGGCCGGGAAGAGTTGCTCCGCCTGCTGAGTTCGTT
TGGCTCTATTTATCAAATGTTGAGTGTGTACAAGTGTCTAGAAGCACTGGAAATGCTGGAACGGCTTCCTGACGCTCAGCGTGCATCCGGTTGGGCACAG
CAACAGACTGGTCGAGCACATTTCGAAATGGCGGACTACGTGCGAGCGCACGAGGTGTTCTGTGCTTTGCACAGAGCGGAACCGCATCGGATGGAAGGTC
TCGACATGCACTCAACGACATTATGGCATCTTAAGGAGGAGGTGGAACTGTCGTATTTGGCTCAGCAAGCAACAGACTTTGACAAGTTATCGAGCGAGGC
CTGGTGTGTTGCTGGCAATTGTTTTAGCCTTCAAAAAGAGCACGACACAGCGTTGGCCTTCTTTCAGCGGGTAAGTTGGTTCGGTTGTATCACGAGAGTT
CAAATTGGCATTGCTGACGTATCCTACGGTATGTCTGCTATTAGGCTATTCAACTGGACCCGTCGTTCACATACGCGTACACGCTCTCTGGTCACGAGTA
CGTCGCAAATGAAGATTTCGAGAAGGCAGTGAATTGCTACCGGCATGCAATTCGTACCGATTCACGGCACTATAATGCGTGGTACGGCCTGGGCGCGATC
TACTACCGGCAAGAAAAGTTCGAGTTCGCCGAGTACCATTTCAAGCGTGCGCTCGAGATCAATCCTCGGAGCTCGCTGCTGCACTGCTTCCTAGGTATGG
TTCTACACGCCACCCAACGGTGTGACGAAGCCCTGACCACCCTCGCCACCGCCGCCGAGCTCCAGCCATTAAACCCCCAAGCTCGGTTCCAGCGTGCCAA
TGTCTTGATCACCCAACAGCGATACAAAGATGCTCTCGCAGAACTCCATGTCGTCAAGAACTTTGCGCCGCGCGAATCCTCGGTGCACTTCATGATGGGC
AAAGTGGCCAAGAAGCTCGGCCGAACCGAGGAGGCGATGAAGTACTTCACCTTGGCGCTGCACTTCCACCCGAAGGACAATAACCAGATCAAAATCGCCA
TCGACAAAATCAACGAACCGGACCATGACGACGACGACCGCATGTAGCGAGTCATCGATGCATCTGCAGCGCCAAAGCAGTAGCCTACGATATACTTTGA
GGTAGATAACAGCAGCATCAATGAAGCTTTTTCACCGGCCACATAGACATGGCCGTTTTGCTTTTATGTGGCATTTGAGATGGTGCCGCCAACAGTGAAA
GTCGAGGCGCTGCTGCTGCTGCAGCAACTCACGCTGTTCAAGGAGGCGAGCGAGGCACTCACCCGTCTGTTCGAAGGGTTCTCTGAGCAGGATTCCGGGC
GCTGCGCCGTGCTGTGGCAGCTTCTGCAATGGCAAAGCACAACCGCGTCCAGCAGCCTCGAGGATGTGCTGGTCGACTTAAAATCTAGCGGTGACAGCAG
CCAGACGGAGGTGCGTAGCGATATGGAGCTCACGGTGCTGGGCAAACCTGCTCTGCTGTTTGCCGCCTCCATCTACGACGAGGAACTCGCCATGTTGATC
TGGTCGGGGTTCGTCCAGTTCCACGCGCGCTACCCGCAGTTTGATCTGCCGCGGCAGGTGCTGGACAACTCGGACGACTCTTTGGGCTATTCGGCGCTGC
ATTATGCCGTGGAAGCGCAGATGACGGACTTCCTGCGTGCTGTGTGCAAGGAGATGACCCAAGCGCAGACAGCTCCTCTTGTCGGCCGAGTTGTGACGCA
AGACGTGACTTTGCCAGTTAACACCGCGCACACCATGGGCAAGAACATTGCCAGTGGAGGCTGCTCGCTGCTTCATCTTGCGGCCAAGAAGGGCGAGTTG
GAGATGGTGCAAATGCTGATTGCACCCCCGATGCTCATGGACCCCAAGACACTGCGCGACTGGGACGGCAACTCTCCTGCTCGAGTGGCAGCCATCCACG
GACGTGACGAGGTCGCTGCCTTTCTAGAGGTACGGAAGTGCCAGAGCAGTTTGCGAAGTAGGTATTCTAATGGTTATTGTGGTGACTGCTTAGGGTATCA
CTGGGGAAGCACCATTGAGTGTTTCGGAAGTCGATGACCTGCGAGCCAAGCGCGAGAAGATGGCCAGAGAGCGTTACCTGGCACACCTGAAGCCCCAGGA
GTCCATGCTAGAGCCTTCAGTGTTTGCCAATATTTGGACTCTCGAGGAATCGACGCTGATCAGCGATGAAGTCAACCTCTTGGCCGCTGAGCAGGGTTGG
TGCAAGGAACGGCACGCGTCTTATCAAACGACGGACATGCCGTGCCACCACGTTGCTGGATTGAACTCCTGGGTGCGCGCGACCTTGGCGGACAG