Description :
From Genome Similarity Track
Location :
Scaffold_340:41983- 48788
Transcript NameFunction/comments
Phyin_T30-4PITG_21601Putative uncharacterized protein
Phyin_T30-4PITG_21602Pro-apoptotic serine protease nma111-like protein

Sequence
6805 bases(100 bases per row)
GAAAGCTGAACTAGGAATACTGCCCACACTGCTTAGAGCCTGTGCTTCGTACCAGTAACTCAGACCGACATCGTAGTATCTTTCAGCAGCGATTGCGCCA
GAAACGCCAGGGGCCTCATTTACGCTCTTGCCGGCAAGTAGGACGGCGGCCTCATACGCCTTCCGTCCCGCGCTGATAAACTCTACCCAGCTGGACCCAT
CACTTGAAAAATCGTTCGGCGACAAGTAGTAAGCAAAGCAATGAATATCACCGATCAACTTGCACGCTTCCACGGACCCTGAAAGAGGAGAGGTGGACGG
CAGTCCCTTCATCATCCGTGATGCCTCCTTCAGATTAGCAGCAGCATTGCCGTACAACCCCTCGGCACACAAGTACTTAGCTTGTTGGAACAGCAAGTCA
GAGTAAACCATGGAAGCCACCGTAACGTCTGGTTCACTATCCGCCATCTCGCCGGTAATAACAGGGTTGATACGCTCCAGAGCATCATCAAAGAGCAGCA
ATAATCCTTCGATACGAGCCAGCTCACAGCGAACGCACCAACTTTCTTCACCCAGCTCAATAGCCTTCAGATATGATCTCTGCGCGGACACTTGCTTGTC
GAAGTTTTGGTAAACATGCGCCAGAATAACCCAGTAACGAGCATTCATAGGGTCATTGCGCAGGACCAGATGCATTTTCCCCACTGCTGTCTCGTCGTTT
TTCTCTACTAGATGCTGCGCCAGTCGCAGAAGTGCCCAGGTGGGGGCAGTCTCTTGATCCTCTGTCACACGCTCCCACAATTTGACGTTTGTTTCGTACT
TCCCCTGCTGATCGTACAGGTCGCTCAGAGCCATACCTGCTAGCTTGTCGGTGAGAGACAGCGATAGCGCCTTCAAGAAGCACTTTTCAGCACGCAGAAC
ATCCTTTGCGACTTCCAGGTACCATTTTCCCAACCAGGAAAAGATCTCTGCGTCAGATGGCGTCAACTTGGCTGCTTGCAGTAGATGGCCAAAACATCCC
GTCTTGGCAGTTTGGTGAGAGCCTCCAAGATGCCAGTATACAATTGCCAATCGCTTGAGTGCTCGACCTCTAGCAGAAGCATCAGAGGAGGAGATCTTGC
TCGCATTTGTCTCTAGCAATGCTTGAGCCTGCTGGAGATCACCAAGCTGGAACTGCAGCCACCCGCGCGTGCAGAGTACAACAGCACTCATTTGCTCATC
CTCCACGTCAGACGACGAGACACAGTCGATGATGTCGAGGGCCTCCTCCGCTCTTGTCTTTCCTGCCAAAAGCTCCGCTGCTGCAACTGCTGCCCTAGCC
GTGAAGATAATATCGTCGTTTTCCATGACCCTGCGGTAGTGCTCCAGAGCTTTATCTATATCAGCAGAATATTCACGTGCGGTTGCTGTCATGAATTGCA
CCTTAACTTCCGAATATCTGTATCGTGCAGATACATGTTAGGCAACGAAGTTTAATACAGCGCACGTAGCACAACTTACAGAGCAGGAGTTGGGCCTTCT
GACCCAAGCATCGTTGACTTGTCAGCCACTACCTTTCTTGCCAATGCTAAACGATTCAGACAGCCATCAACGTCGCGAGCAGCCAGCGCAATCGACGCCA
GTTCGATTTGAACGCGAATGCAAAGAGCGCACTCTTGAAAGGATGAAGAGGAGTAACCTGCGAGTGCTTCAACAAAATTTTCTCGAGCCTGATTCAGACA
GAGAACGCTTGCAATCGTCAACATCGTAATACCAGACAGTGAAGCGTATTCAGCACTCACCTGGCTGTTGTCCCCCACGTGCAAACACTCGATCGCTCGG
AACACAAGAGCCATAGGACTCTTCGGGTGACTCGCAGACAGTCGAACAGCAATCTTCTTGGCCTTTTCCAGCCCAATTGCTGGCATTTACAGTTGTGCTT
AGTGCCATAGCAGCAACGAAAGCAACAACACTAAAAACTTACGAGTGTCCTGGTCTTCAGAGCGGAGAAGTAAGAATTCCGCTGGGATCTTGGATTCGGG
AAACCACTCCACGATCGACATGGCCAACGCATCCAGCGTTTTCAGAAGAGCAGGCTTCTTTTTTGAAGTTTTCAAGAAATCCAGGTGGAAGCGCATGAAG
AATGCAATCGCGACGTCCATTCGAGGTCGAAGTGCGTCGATTTCTTTGTTCTGGGTTGTCCAGTCGGTACGAGAAGCAGCAGTAAAGAAGTGACTCGAGA
TGTCTGCCATGGAGTAGCTGCCAGAGCATTCTGATAGACTGAAGCCAGGACGCTGTACCACACGTCACAACCATACTTCAGCATAGGTCGTTGCCTTGCT
GGGCAAAATACTACCTTACCTGTAGCAGATCCACCAAATCCAACCAGATTGTCAGTGCAGTTGGTAGTTCGTCGTTTGGGGTCTTCTCCAAGGAGAGCTG
ACCCGAATCTCCAGATTGCTCCCCCACAAGTGAGTACCAAGAGTCGAAGGCCTGCTCCGGACAATCAAAAAGCAGAAATATTGAGTTAAAAACCATTGTG
GAAGCATTTCGTAAGTGCCTAACTGCGCAACAACAAACCTTGGGGAGCATTTTCAACTCCATTGCTGTTGCTGCCAGCTCTACGACCCATTTCTGGCATT
TCTTCAACTTCTTGCCTCTGTTAGCCGCCAGAGCACCGCAAAACATCAGCTAAAAGATCCCACATCCCGTCTCTCCTAGTTGCAGCACCTCAAATTTAGG
TCCACAAGTTTCTGAAGCGGCTCCAATTTGCTCTTGGCGTCCTTCTTCGCCTCAAACAGGTCCACAAGATACTGCAAGCCATTGTAAGCTCAGTTCCTGC
CACCAATAACAATTTTAAATCTGTCCTCTAAACCTTCCACGGCGCAGGCATGTCCGGCTTGAGATCTGCAGCGCGACGATACGCCTCCTCGCAGTCTTCC
CACTTCAGCAACGACAAATGTAATATCAGCATTTGATACGCTGGCAAATGCGGGACGACGCACCTCCTGCAGCTGGAAGCTAGCCAGTCCTACGCACATG
AAGGCCTGGAAGTTGTTAGGGTCAAACTGCGTCACTCGACGACCAGCATCCTGTGCCTCCTGGAAGCGTTCGGCCTTGAGCGCCGCCGCCGCGTCCAGCA
GCATCTTCTTGAGCATGGTCGCCGACATGGTCGTCCTGGGCCGAATAATATCGCCTTCGATAAAGTAATTGGGCATTTATGAGAGATTGGGTCAAATAAA
GGGTACCAAGACCAGGACCAGTTGAACTCGACATTCACTCTTTGATTTGCCATCCCCTAGTCGACCATGTGGAAGGCAGGTGCGACGGCGGCGCGGCGCT
CACTGGCGCCGCTGCCTCGGACTCGGGCCGCTGCTGGGGGTGCGCAGAAGCTGTATCGGCGTCCGCAAGCGCTGCAGACGCTTCCCTTGGGACTGACGCG
ACCCTTCTCCACCTCCTCCTCATCAGCTCCAAGTACGTGGCCTGATCTCACATTCGAGGGCTTTAAGATATTGAGATATTTTGCGTTATATAGCGACGCA
GAATGCGCAGATGGCGGCTGCGGCGCTCGCCGCGTGGTTGCGGTCGTACCTGTTTGTGTCGACGGGGCGCCAGAGCGAACAGGAGAAGCAGCAGCGCGAG
CAGGAGATCGAGCGTCAACGCAAGCTGAGTGACCGCCTCGCCGCGGAGCTGGTGGCAGCGGAGGCTAACCAGAACAAGCAGGACTGGAAGTCCACGCTCG
AGCGCGTTGTGCCGGCCATTGTGAGCTTGAAGCTCAACTCGCCCAAGGTAGGAGGATGGAGAACGTTGTCGAGGTGACGTCAACAATTATTGACAGGGAG
ATTACGTGATTGGCTTTTGTAGTTTTTTGACACGGAGTCGCCGGGCAACGGATCCGCGACGGGTTTTGTGGTGGACGCGGAAAAGGGAATCATTTTGACG
AACCGCCACGTCGTGGGACCTGGACCCATTGTACGGTGGTTAAAAAAGTTTTGGATGGCGATTTTGCTTTAGGTTGCTGACTTTATGATAATTCTTGGGG
TTTGCGCGCTTGTGCAGGATGCCGAGGCTGTTTTCAGAATAATGAGGAAGTGCGGGTGATCCCGATTTACCGAGATCCGGTTCACGACTTTGGCTTTTTC
CAGTTCAACCCGGCGGTACGTTGTGTCTGCTCACTTTCCTCTTGTTTTTCTGCTAAGTGAGCTTACACCTGATAAGCAGGATGTTAAGCACATGTCGGTG
CCTTCTTTGCGTTTGGAGCCGGAAAAGGCTACCGTTGGGACGGACATCCGCGTCGTGGGTAATGATGCTGCTGAAAAGCTCGCAATTGCTAGCGGTACAC
TGGCGCGTCTGGATCGCGATGCACCTAACTACGGGTACAACAGCTACAATGACTTCAACACGTTCTACTACCAGGCGTCGTCAGGAACTACCGGCGGTTC
ATCCGGCTCCCCTGTGCTCAACCATGATGGTGACGCCATTGCTCTTAATGCCGGCGGCAAGATTGGCACATCAGCTTCCTTTTATCTGCCCCTCGATCGA
GTTAAGCGAGCATTCGATTTAATTCGAGAAGGTAGGGAGGTCTCTCGCGGTACTATTCAAGCGCTTTTCCACTACAAACCCTTCGACGAGGTGCGCCGGC
TCGGTGTTAATCCCGCCACAGAAGGGCTCGTTCGCACCTCCTTCCCACTCGAGACAGGAATGCTGACAGTAGCTGAAACGATTCCCGGAGGCCCGTCGAG
CAACAAACTGCAGCCTGGTGATGTACTGGTACGCGTCAACGGCGAATTGATCACGCGGTTTGTGCCATTGGAGGCCATACTCGACGACAATGTTGGCGAG
GAGGTAGATATTTTATTTCTGTCTAAGTTGCTTTACCACGCTGACTCATTCCCCGCGTTTTTCCCGTAGGTTGAGATTCAAATCGAACGCTCAGGGGAAC
TGATAACGCACAAGGTGCAGGTACAGGACTTGCATTTCGTTACTCCGTCGCGCTTCATCGAAATTGGTGGTGCTGTCATCAACCCGTTGTCGTACCAGCA
AGCTCGAAACCACGCGATGAGCCCTGGAGCTCCGTACGTTGCAGACCCGGGCTATTTCCTTCAACGTTCTCGTATTGGTCGCGGCTCCATCATTCACTCT
GTAAATGGCACCAAGACACCTGATCTCGAGACACTCAAGAACTATCTGAAGCAGTGCAAGGACCGCGATCGCATCGTGGTCAAGTTTTCGAAGTTGACCG
ATAAGTCTGAAAAAGTCGAGGTTGTGCATGTGGACCGCAGGTGGTTCCCGTTCTGCGAGTATGTACGAGACGACAAGCTGGGAACATGGCATTGCGAACA
CTTTAGTCCTCCCAGCGAAGACGGTTCTGCACATGATGCTGAAAAGAGCAAGACCTCAGCCGAAGAGGAGCCGATCGGTTCAACGACTACCTTACCGGGC
AAGAACCCAGTGGAAAACAAGCTTGCGCGGTCGCTAGTTACGGTGGACTTCGACAGACCATTTAGCGTGAACAGTTTATCGACGTCGAATTACCGAGGCA
CAGGGCTTGTGATCGATGCGGCGAAAGGGCTAGTGGTTGTAGACCGCAACACAGTGACCGACTCAATGGGCGATGCCATGGTGACTTTCGCCAGCACCAT
CATGGTTCCGGCTCAAGTGGTATTTGTCCATCCGGTGCATAACTTCGCCATTGTGCAGTACGATCCGAAGCTCATTGGGTCCACGCCCATTGAAAGCTGT
CAGGTGGCTTCTAAACCGCTGGTGCCATCCGATCCTGTGTGGCTTGTTGGTCTCATGAGCAGTGTGGGTCGTAGTGGCCATTCCGATCTTGTGTCTCGCG
AGACCATCGTATCTGGTGTGAAGTGGATTGGATTGCCCATGCCCAACCCACCGCGGTACCAGGAGCATAATCTCGAAATGGTTTCTCTGCAGGACGTTGT
TGGCACCGAAGGCGGCGTTATTTGCAGCGACGAGGGCGAAGTGAGTGCGTTCTGGGCCTCTTTCTCATTCCAGCAGCAGCGTCGTAGCTCCAAAGTGGAA
AGTCAATTTAACCGTGGTATTCCGATGGATCTGATCATGGAAAGCGCAGCACCTCTCATGCGTGGAGTGACACCCAAAATCTACGACCTGGGCGTTGACT
TCGAACACTTAAGTTTGGCTAAGGCTCGAGAGCTTGGTCTCGGCCAAGCTCTAGCCGAGATTCTGGAGAAGGACGCGCCGGATCGCCGAACTATCTTGAG
TGTTGCACGACGATGGGGTGGCACAGAGGCCCAAGATGTGCTCAAGAACGGCGATATCTTGGTCGCTGTGGACGGCAAGATCGTGACGAGTTTCCGCGAG
GTAGAGCGCTGTACGCAGAAGCCGGAGGTGCAGCTCACTATTGTGCGGGATGGACGCGAGATGCAACTAGACGTGAAGACCCTTTTCATGGAGCGCACGG
AGATTAACCGCATCGTTTTCTGGCAAGGTCTCTTACTACAGGCGCCACCGCTTTCTGTGTCTGCGCAACGCAGCATCTCGTTGGAGGATGGCATATACGT
GTCCTGTCGGTACTCGGGATCCCCGGCTGCTCGGTATGGCCCGCCGCCCACTAGTCGCATCAAGGAAATTGACGGTATCAAGATTACAAGCATCGACGAT
TTCTTGAGCGTCGTTACTGCAAAATCAGGCAGTGACTCGGTGCGCATCAAATACACGGACCTCAGTGGCAAGGACCGTCTCAGCACACTCAAGCTCGAAC
CCAAGTACTGGCCGACGAGCGAGTTGGTGCATGAGGGTGGAGAATGGCATCGGCTCCAACTTTAAAATGCTCCACTAACTAACCTCTGTTTAGTCGCATG
CAGCG