Description :
From Genome Similarity Track
Location :
Scaffold_42:419819- 427725
Sequence
7906 bases(100 bases per row)
ACTTCATCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGATTAGGAACGATTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGACCCTGCAGAG
CCTGGTGGTGTCAACGCCGGCTGAGCAGCTCAAGCGCGTCAATGCATTTGACGCGTACGAGCAAAGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGACTGAAGGTTAAACCATATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCAAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTA
CACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCTGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTATTCATGGACGGCCTTCGAGTGGGGCCCGCACGCACTAAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAAAAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCGTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGTTCCCATGGAACTCGGGTTCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGATAAGATGAGCCACTTCAAGCGCGACTGTCCCGCGT
AAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATTCCGGGGACAGGGGAGCGCCGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCAGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGTACTCTCGAATCGG
CAAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTATAGAATCTTGATCGACTCTGGGGCGTCGAAGAATTTCGC
ACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGCTGTCCGATGCTCTGAGAGAAAGCAAGTAGAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAG
GTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATA
TGATCCTGGGCATGCCCTGGCTTGAAAAGCACGAGCCCTGGATCGACTGGCGAGGCAAAGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATT
GGTGATTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGGTGCTTGGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAAAGGCGCTGACCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAG
CTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATA
CGCCTCCTGTGTGGGTAACACAGTGCCACACGTGGTCGCTCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCA
CACGAGGCCACGCGTGCCTCGGATGTTGTAGCGACGACATCCCTAAACGTGGGCAGCAAAGCTCCCCGTCACAGCCGCCGTCGGCAACGACGCCGCCGCC
GCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGTGACTCGGAGTCCAGGGCCCGGGCTCCTCCAACAAGGCCGGTGGAAGAGTG
TTATCACATCTTCTATGGCGAGACCGGCTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACGGCACCTCGAGGAA
ATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGAAGAGATTGCTGAGATGGTACTCATGAGATCTGAGACCACTCAGAAGGAGCTGAACTCCTCCT
CTGTCTTGGACGAGAACGTCCTAGAAGACATGAACAAGCAGCGTCAGGCGCGCTTAGGTTCTGAGATTCTCAAGAACCCAAGGATCCGGTGTATCCTTTG
GTGACGGAGTACGCGGACGTGGTGAACGAACACCCACCGACCCAAATCCCACCGGATCGAGGCGTACGGCACAAGATTGATCTCGTGCCCGGCACAAAGT
ATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCTTTCTTCGCCGCGAAAGCGAAGGCAGGGATGGTGCGGGAGTCGAA
ATCCCCGCACTCGACGCCGACTTCCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCC
CAAACACCAATCCCACGAAAGGATGTGTTGTTGTTCAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGA
TGAGAGAGAGCAATATCCCGTTTACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGAC
GTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACGGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGGAGGCAA
GACGGCCATGGAGGTGCATCTAGGCCACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCA
CCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAGGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCC
AGAAGGATCTTCAAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGACTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAA
GGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACG
AAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTAGTTCCAAT
CCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGG
CTCTAGGCCCTTTGTGATCTACACAGACCACGCATCCTTGAGTACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCAAGGTGGCTGTCCTTCTTC
GCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAAAGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGC
GGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAA
GTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCAACTGATCCACCACGG
GTGGTCGTACCCAACGACGAGGATCTTAAGTTCGGCATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGT
CGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCTCGGTACGTTAAGACATGCGAAAATGTCAGCGGGTCAAACCCGCAGGGCACTCT
TCGGCCCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCG
GAATTTTGGTGTTTGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGCTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTCGCTCGTCGATGG
CGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCACTGCCGCGTTTTGGATAACGCTGTTCCCTTTACTGGGAACT
CGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGTGCAGTGTGTGCGCGGCAG
CACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTT
CCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCATTTCCTCCCAGGTCTCGGAT
GTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATTCTTTATGGATACCAAGCTGAGCATTATCAGCAGGGTCCGCGATGCCATGTCAGCGGCCCAAGATA
AACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGGCTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACAC
TGTCAGCTCTGTCGGCAGCGACAAGCTGAACCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAG
TCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTC
GAAGCGAGGGCCGGTCACAGTCGTTGACGAGGTCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGG
GCTCCGTACGAACGGACCCCGGAGCCATACGCTGAGTACGTCGGGTACGCACCATACGCGTACGTCTGGGAGTGCGTCGAAGGGGGCTCCGGACGTGGCA
ACAGAGCCTCGATACGTCGGTTCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCACGCTC
CAAGAGGCCCAGGTGGCCCGCAAGACGAGCGATCTCGCCTTGATTACCGGCCTGGGCGGCAGCATCGCCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGC
ACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGATTGCT
CGTACTCGTACGAAGGCACCTCCGCCCCTGCTTAACCGGAATGGAGAAGTCCACTTCCACGTGGAGCAGATCCTCCAGGAGCAACGGCGTCGCGGTAAGC
GACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCCCTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCTCGAAGGCTGTCGCAATCTG
GGAGCAGAAGCGGCGGCAGCGTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCGTACCCGCGCTCATTGTGAGCGC
TAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAG
CAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGGGAGTACTTAAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAG
GTCTCGGACATAACCCAGGGGTATCCTCAAAGTGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGT
GTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATACCCCTAGAAGTGTGGCC
GCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGATCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCC
TGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTGCTGGTCGAGGTTATTCGAGACCTCCCGGAGATCAG
AGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCAAAGATACTCCGATAGGAGCCACGAGTCTCCTTCTCCTCGCG
GAGTGGAGACTTAGAGGCTCTACGCTTCTTTGAGGGATTTGGCGCCTTCGGCTTTAGAGGCCTTAGCATGCGCAAGACCCTCGGCAAGCGAGAGGCGTTT
GCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCTTTAGCCTTGGCGGCCGGACTCTCGGAGTGCACAGAAGTCCTGGGACTGTGATCACCT
TGATCACTAGCGAGCGACTACACGCTGTCATCTTTGTGCTCACTGTGCACTGGGCTGTTCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGG
ACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGGGCGACGGACTGCGGCGCTTGCT
TGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTTCCGTGAGGCTTAGTG
CTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGCGCGGGTTTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCAAATTGGAGACCTAGA
CGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTATGAATTGATCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAG
TTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACAT
GAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGA
CATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCG
CTCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAGGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCC
ATCACA