Description :
From Genome Similarity Track
Location :
contig_32:419817- 421506
Transcript NameFunction/comments
g6240.t1hypothetical protein

Sequence
1689 bases(100 bases per row)
CACCACAACATACAACATCCTGAGTGCCTAAAACGTCGGGTACGACATGTCGCCGTACATGCCACAAGTGCCCGTGCTGTCACTCGATCGCTCTAGTCGA
ATGTAGCCCGACTCGCCCCAGTCCTCGCCCCACGAGTTGCGGATCTTCCACTCGCTGTCCGTGTAGCCCACGACCACGACGGCGTGATCGAGGTCGCTAG
TGTCGCACGACGAAATCACGCCGCCCGTGTACTGCTTCCACGCGTTGTTGCCCGACGCCACAGCCACGATCACGGGCTGCTGGGCGACCAGTGGCAAGGT
CCGACGCGCCATCCACCGACTCGTATCCGGTGATACCCGTGTCGACAGCCGAGCAACTGGTCGTGCACGAGGCGGCCGTGCCGTCCGAGGACGTGTACGG
GTAGTCGTCCTCCGTGCAGAGGCCGTTTTGCTGGACGTACTCCATGGCGTAGACCGGAGCTCCGCCAGAGCATCCGTAGTTCTGGGTATCGCAGCTCGTG
AGCTGCTGCTCCGAGTACTTGTTGAGAGACGATTGCCCGCCCTTGATGCACTGCCCCGACTCGATGGCAGCCGCCGTCGAGAACGCCCAGCAGTCACCGC
ACGAGCCCTGACTCTGGATGGGGGACATGCACTTCGAGTCCGTCCAGTCCACCTCGTCCGAGCTTGACGTGTCTGTAGCAGTCACCGTCGAGGTGGAAGC
AGAAGACTTGGTAGGCGAAGTCGTAGCCGGCGTAGCAGTGGTAGGTGTTGGGTGGTCGTAGGTGCCGCAGTGGTCGGAGCCGATGTGGTTGGCGCCGAAG
TAGTGGGCGTCTGCGTAATTGGCGCGCTGGTCGTGGTTGAGCTCGAGTCGGAGCCGGCAGGCTTGACGGTCTCAGGCTTGAAGTCGTTCTTCCCCATGCC
GCCGAAGTTGAAGCCGTTGCCCCACTGCCAGGGAGATGTGAAGCCCGAGCCGAAGCCGAAGTTCGACGCCGTGTTAGCGCCTGACGATGCCGTGTTTGCA
CCGGTCCCCGACGAAGTGGTCACTGTTGTGCTCTCGGTTCCTGGGCCCGAAGACGTGGTAGTGCTCGTGGTTGTGCTGCTTTTGCCGTCCGCACCTGTGG
TGGTGACAGTCTTGACGCTAGTCGTCGAATAAGTTGCGTCTCCGCTCGAAGTGCCGCCCAAGACTGAGGTCTGTGCACTGCTCGGGGCGCCGCTGCTGGT
ACTTGTGGTGGTCGTCTTGGAGGTGGCACCGCTGCTCGGAGATCCACTGCTATATGACGTCTTGGTGCTGCTGCTCCTGTGCCAGCTACGCAGTCGGCGG
TTTGTGGAGCTACTGCCGACCGACGATCCGTTGAAGGCGCGGTAGGCCTTGCCCACGTAGGCGGCGAACTCGTCGTTCGTGAGCAGAGTGAACGGCGTGT
TGGTGGAGAAGTTGGCGTTCGGGTTGAGCGCCTGGATGGCGGAGATGTTCTGCTTGGTCATGAAGAACCGCTGCAGGTGGTCCTCCTCCTCGTCATCGGA
GCTGCGTTCCTCCGAGTTGCTGCTCGAGGGCGGCATCCAGCCGTTCTTCTTGGCCTTGTCGCCGAAGTTGGCCTTCCAGTCGTCGAGCTCCTGTCTGGTC
TCGTTCCGCTCGCTCAGGTAGCGGTGGTAGTCGATTCCGGCGTGCATTTGACGCCCGTGCACGCCGGACACAGCCACCGCCGCAATGGC