Description :
From Genome Similarity Track
Location :
Scaffold_620:4198- 5278
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_620-fgenesh-gene-0.1HECT E3 ubiquitin ligase

Sequence
1080 bases(100 bases per row)
GCTCGAGGACTCGCTGGAGCAGATGCTCAAGTGTCCGCCGAGTCGTTTCTGGGAGCGGCTGCGCATCTACTTTGAGAACGAGCCGGGTCTGGACGCTGGC
GGTCTCATCCGCGAGTGGTACGAGATCCTGAGCGAGAAGCTGTTCAACGACGACTTTGGGCTGTTCATCGCGACCAAGGGCGAGAACCTCGGGTACTGGA
TCAACCCTGCGTCGGCGTCCAAGGTGAAGGACCACCTGCTGTTCTACGAGTTCATCGGTCGCCTGCTGGCCAAGGCGCTGATCGAGGGGTACAACATGAA
GATGTCGCTGGCGCTGCCGCTGATCAAGCACATGCTCGGCGTGCCGATCTCATTCTCGGACCTCGAGTTCCTCGACGAGGACCTGTACAAGAATGCCATC
TGGATGAAGAAGAACGACCACGCCGAGATGCTCAACATCGACTTCACGGTGCAGGTGATCACGTCCGACGGCAAGTCGGAGACGGTTGAGCTGGTTCCCG
GCGGCAGCAACATTGACGTCACGGACAAGAACAAGAAGCAGTACCTCGACCTGTTGCTGAAGCACTACATGTTCGAGAGCATCTCTGAACAGCTCGGCGC
GCTGCTCAAGGGGTTCTACGACGTGATGCCGCAGTTCCTGATGACGGTGTTCGACTACCAGGAGTTCGACCTGCTGCTCTCGGGTATCCCCGAGATCGAC
GTGAGTGACTGGTACGCGCACAGCGAGGTGCGCTGGATCAAGCTGGAGAAGCCGACGCCGGCCGAGCAGCGGGTGGTCGAGTGGTTCTGGCAAGTGCTTG
CGGCGTTCACGGCGGAAGAGCGCGCGCGGTTGCTGCAGTTCGCGACGGGCACGTCCCGCGTGCCAGTGCAGGGGTTCAAGGCGCTGATGAGCAGCGACGG
CCGCGTGAGGAGGTTCACGATCCAGATGGTGGTGCGTGGACCGCCGCCGACGGGTCTGATGCCCAAGGGCCACACTTGCTTCAACCGCATCGACCTGCCG
TTGTACCAGACGATGGAGGAGCTCATGAACTACCTGACGCTCGTGATCAACATGGAGATCTCGGGCTTCTGGCTCGAGTA