Description :
From Genome Similarity Track
Location :
Scaffold_90:41977- 43558
Transcript NameFunction/comments
Phyin_T30-4PITG_19199Arginine N-methyltransferase%2C putative
Phyin_T30-4PITG_19200Geranylgeranyl transferase type-1 subunit beta%2C putativeGeranylgeranyl transferase%2C putative

Sequence
1581 bases(100 bases per row)
CGATCTCCGTTATGTCGCGCTTCGGTGGCATTGCCGGCTGGTTCGATGTTGACTTCAGGGGTTGCGCTGAGAACCCGGCCGAGAAGGAGGTGACGCTCAC
TACGTCGCCCTTCGTGCAGCCTACACACTGGGGGCAGCAAGTTTTCCCGCTATACCCTCCCATGCAGGTGTGCGAGGGCGACGTGGTGGTCGGCGAAATC
GCCGTCATGCGCCGTGCTGATAACCAGCGTCTCATGAATGTCAAGTTTGACTTCCGAATCCGCCGCCCCGAGGACGACGACGAGAGCATGACAGGCCCAC
CCAACTCGGCCGTTTTCCAGATCGAATAAACAGCTTGAACTAATGATTTTGCATTGACACTTGGTTGTATGACGCTGCTCGAAGCTACTACTACTACTTT
TAAGTACGGTAGTAGTAATAACTAACGATGTGAAGTACTACTTCTTTACTTTCTCTTTTTCTTCACCCTGTACTGTACTTGTTATATTGTATTAGAGCGA
AATATCACTTTTTATTCTTGCACGGCACGAAGATGGCAACCACGTTTGACCGGGAGCTCCATACGCGCTATTTCCTCAAGAATCTGCGGTCGCTGCCTGA
GCCGTACGCATCTCAGGACTCGCAGCGCGTGGTGTTGGCTTTCTTCTGCATCCACGGGCTGGCACTACTGGAGGAACTTGAGCTCGTTGACAAGTGCCAG
ATCATTGAGTGGGTCTATAGTCTACAGGTGTCTCCAGACTGCCGCGACGTCAGCCTCAATGCGGATGACTGCGGTTTCCGGGGCGGCACCTTCATGGGGA
ACACCTTTGGTTGCCCACCGTCCCAGTTTCAAAGCGAGGTGTACGACTCGAGCAACATCGCGTCGACCTTCGCTGCGCTCTGCATCCTCCGGACGCTTGG
CGATGACCTCAGTCGAGTGAACAAGGCCGCAATCATTGGATCTTTAAAACATTTACAGAACAAAACGACAGGATGGTACGGGACAAGCACAGATGGTACA
GTCCTGATGCTGATGGTGGTTCTGTAGCTTTTCGTCAGCAAACGCTGGATCGGAAGAAGATATGCGCTTCGTCTACTGCGCCTGTGCCATATCTTACATT
CTGGAAGACTGGTCCGGTGTCGATCGGGTGGCGATGGTGCGCTTCATTAACTCATGTCTGGTATCTCTCTCCCTCTAGTATTCATCAACTCGTGTCTGGT
ATCAACACGTATACACGACTGCTGACAAGATCGTTCGTTGTTGTGTGTAGAATTATGACGGAGGCATCGGGCTCAGCACTGGCGCTGAATCGCATGGCGG
GGCAGTATTCGTTGCCATCGCGTCGCTGTTTTTGTCTGGACGAGTGATGCAGCTCAAGTGCGAGCAGTCGGATCTGGTGCGATGGCTGGTGTTCCGACAG
CAAGGAGGTTTCCAGGGACGATGCAACAAGAGCCCCGACTCCTGCTACGCCTTCTGGAACGGCGCTACCCTCGACCTCCTGGGCAAACACTCGTTTGTGG
ATATCCCCAGCTGCAAGAAGTTTATCTACTCGTGTCAGTTCCCCTTCGGTGGATTGTGTAAATACCCCGACACCGTTCCCG