Description :
From Genome Similarity Track
Location :
Scaffold_92:41975- 43770
Transcript NameFunction/comments
Phyca_LT1534511625folate-Biopterin Transporter (FBT) family

Sequence
1795 bases(100 bases per row)
ttcagctttaatcccttgctgcaccgccactcttcgtttcgcctgcttcctcgcaagacctccggactcccaagtcaagagcaaacatgcccagcaccaa
cgatttggacgcgcggctgtccatcagcagcgtcaagtccaagaccaaggacattgaggagggcggatacactggcatcaagacccccgacacgaccggc
gctaagaccagcgagaagatcggcgagtatgagggcggtgccctacgccccggtggcatgcccaacctactgagtaaaggctgcatcggtctgctgttcc
agtacgctgtggtcggtctggtgtatggtgtgctgcccggaaccatctacccgttcatgcagcagtacttgaactgctccggatcccaggtggccgccgc
gaagcagctcgtagtgctgccgtggagtttcaaggtcttctacggcatcatgtccgactgccgcccgatctacggctaccgtcgccgtccgtacatgctc
atcggctggaccatttgcatcctcacgctgctggccatggctatcatgccgatcggcaagccgtactacacggtcgcggcggaccgtgacgtcgccgtgg
ccgactacacggacgagatccggaaccggatcaactacgacgctccatcggaaggcgccaagtacgtcatcatcatgctgttcgcggcgtgcggctacgt
tctatcggacgtgtgtgccgacagtatcacgtgtgaactggctcagcaagagccgatcgacaagcgaggcaagacgcagtcggccatctacgtcgtgcgt
acggctctagtgatcttcggtgagctgctcacgggtttctgcttcaacggtgatgactacggcggcgatttcaacttctcactgagcttccctcaactca
tgatcatcatcacggtgctgtcactaccggtgctgcctatgacgtggtgcttcatccacgaagacaaggccgaacctgccaacttccgtcagtacatgaa
cgacttctgggacttgatgtgctcgcgtgccgtgtaccaggtcatcgcgtacaacttcttcgccggcatcttcgctaccatcacgtacacggccagttcc
cctgtggcctcgtacatggtgaacgtcacgcctatcaacagtaccgtcagtgatatcctcagtaacctgctcttcatggccggtatcatgatcacgtcca
agtgggggcttcactggaactggcgctggatgatcattgccacgggtgcagcggttatcatcgttgactgcgccgtcgccatgatggtcgtctgggacgt
ttaccgtaaccagtggttctggctgggcccgcctattgtggtacagctcccgtacggcgtcggctggatcatttcgacgtacgtcgttgtggagctcgcg
cagatcggtaatgaagctgctgtctacggtctcatcactaccgtctccaacgtggcacagccgttcgccacgtccctctcgttgctgatggacggtccgt
ttaacatcaccaacgaccgcgtcaaggaggacgaccactctgtccgtatggacatcacgtacacgatcatcattatgtacacgtgcatggccttctcgtg
gatcttcctgttctggctcccccgacagaaggaggagactcaggaactactccgtcgtggcggtcacagcaaactcttgggtggcgttaccgttgcttac
ttggtcttcgcgattatctggtccattatgaccaacatcatggccatcttcgacagcacgtcgtgtttgatcatcgctggtggaactggttgtta