Description :
From Genome Similarity Track
Location :
Scaffold_481:4197- 6531
Sequence
2334 bases(100 bases per row)
GCTAATATCAGCAAGCTTGTCAGCATACTCTCTCCCACCAAGCCCAGAACCACGAAGTGGTAATGTGATCAGAACGCGGGGGTGCGTGAGGCTATATAGA
GAAGGGAGCGAATCCGGTTGAGGCATGAACAGCGTTGTTCAACGCGAACTCAATTACAGGAAGCATCGAGCTCCAAGTCTTAGGCAACTTAGAACAAACA
CTGCGAAGAACGTCGCCGATGACGCGATTAATTATCTCAGTCTGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAATCGCGTTCCAAGCACCT
TGAAGATGGAAGCCAAATTTGCCGGTGAAGCGAGGGTCGCGATCAGAGATGATTGCCAGCGTCGACCCGTGTTGACCAAACACACAATCGATAAACAGCA
TAGCTGTACCTTTACCATCGATGGAGTCCGACACCGCCGCCAAGTGAGACATCTTGCTTAAACGGTCAGCAAAGACCACAATTCCCGTATTACCATCACA
GTCTTTGGGAAGGCCAAACATAAAATCCATACCGATGGGCTCTCAACATCCCTTGGGCACAGGTAAACTGGAGAGTGGCGCAGCGAATGTGCTGAGGGTT
TGACCCGCCGCCGTTTCGCATGTACGAACGTACGTGCTCACCCATTGGTAGAGTTTGGGCCACCCGTAGTGTTGAATCACAGAGCCATAGGTCCTTTCCC
GGCCCAAATGCCCACTGAGGGCAGTATCGTGGGCCTCCAAAGAGGATTCGATATTTTAGATCCTCATTTTGAGACACAACAATGCGATGGTATCCGCTAC
ATATGTGCGATAGCACAAGAGGCCATTATCGATGGAATATTGATGTAGGCTGGCCCGCAAGCGTGCCGATAAATGACTGTCCGAGTCCTTGTATTCCTCA
CTCCCTATGACATTAGACAATGCCACACACTGAGGGTCGCGTGGATATGCCACACGAATTAACTGCTCAATAGGAGACGACAAAGTCGTGACATGAGCAA
GCTCATAATCAGGTCGGCGAGAGAGGGCATCGGCCAACACATTTTGTTTGCCTGGCTTATACTTCACCTCGAAGTTATATTCCGCAAAGAAGGAAATCCA
CCGAGCCATTCTCTGAGAGAGGCAACGAGACTGTGTCGCCAAGCGTAGTGACGCACGATCCTTGTAGACGACGAATGGCTTGGAACCAAGCAGATGGACT
CTAAATTGGACAAGCCCGTACTTCATAGCAAGAAGCTCTTTGTCATGAACTGGATCGTTCTTTTTAGAAGCTTTCAGTTGACAAGATTCAAATGAGATAA
TGCGCTCGCGGCCTGCAGCATCTGTTTGCAACAGGGCGCTGCCTATGGCACAGTCGGATGCATCGCAGACGAAAATAAAATGGTACTCAGGATTTGGCAA
CGCCAAAATGGGAGCATGAAGGAGACTCTCCTTTATTGCCCGAAATGCGTCAACATGGGTGTTGTCCCAGCGCCAAACTGTGTCCTTTTAAGGAGATCAA
TTAATGACCGAGATATATCAGCATAATTTTGACTGTATTTGTCGAAGCAATTGACAAGGCCAAGTTACTAACGCAAGTCCTTTTGATTTTTAAAATCGGC
CAGTCCACTATAGCCTTGACCTTATTGTGATCCGCTCTGAGGCCTTCCTTACCGATCAAACATCTTAGAAAAGGAACCTCTTCTGCACTCTAAATGCATT
TGGTCGCGTTGGCAAAAAACTTATATGTGCGCATAGACTCGAGACCGGCTCGCAAATGACCGATGTGATTGTCAACATCTGACCGACCTTGTTCGGCACG
ACTATAGACAAAAATGTCAGTGCGTAATCCCGATGTGGGCGGAAAAGTTTCATCATTTTAAACGCAGCCGGAGCATTAGACAGCCCTTTGACATCACCAG
CCATGCCCATAGCATACCACTCGGAGTTCTCCCTGCCGAAAGCGGGATATCACTCGCTCTCGTAAGAAATTGGTAATATCCATCGACCAAGTCGTGTGCG
CTATACATAGTACAACCAACCATGTTGTTTTTGATAACATCCTTTCGAGGAATAAGTGTCTGTGCTGGAATAGTGGCCGCATTGAGCTTGTTCTAAGCAT
TTACAATACGCCACTTGTCGTTCGGCTTTTTGACACGAAATGTCGATGTCGAATGTAAGGATTTACTCTCACGTACCATTCCTGCTTCGTGCTTGGCACG
GAAGAAGTCGTCAATGACATCACATTGTTCCTTAGGGAAGGGCTACTGTCGTGTGACACAGTATTAGATTCCAGGACCCAAGTTAATATCATGACGGACA
CCTCTATCTGGAGGTAAAGCAGAGGGTGGGTCGT