Description :
From Genome Similarity Track
Location :
Scaffold_81:41962- 43332
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11306homoserine dehydrogenase, putative

Sequence
1370 bases(100 bases per row)
GCGACACAAACACCGAGATCGCGTCGGCGCTCGACTGCTTGGCGATACCGAGGAGCTTGATCGTGGCGCCCATGAGCTTGGCGTACTCGAAATCGATCGT
CTTGATGCGCGTGATGCCCGTGGTCGGGATGCTCGCCGGCGCGACATGGCAGCCAAAGCCGAGCTTGGCGAGGATCGCAATCTTCGCCTGCACGTCGTAG
CCGTCCACGTCGGCGCTCGGATTCGCCTCGGCAAACCCTAAGTCCTGCGCCTCCTTGAGGACCGCGTCGTACGACGCACCTTCCTTCTCCATCTACTCTC
ATGGCGCATAAGCATATCGCATGTAGAAGAAGACGAGGGATACCTTGGAGAGCATGTAGTTGGTCGTGCCGTTCATGATGCCGGCAATCTCCTGGATGCC
ATCGCCCGTGTACGAGCTCTGGAGCGTGTGGATGATCGGGATGCCGCCGCACACCGAGGCTTCGTAGCCAAAGCGCACGCTCGGGTGCGCGGCGAGGAGC
GCCGTAAGGTCGGGCATAAAGTTGGCGATGAGCGCCTTGTTGGCCGTGATCACGTGCTTGTTCTTCGCAATCGCCTTGAAGACCACGTCCTTTGCGTCCG
TGACGCCGCCCATGAGCTCGATCACGCAGTTGATCGACGGGTCCTCGAGGATGTCGTCGTACTTGGACGTGACCGTGGTCGCGTGGCCGGCGAGAAGCGC
CTTGAGCGCCGGGTTGGCCGTGTTGCGGACGCAGACGGCGGCGACCGTGGCGTCGACGCCGACGCTGCGGAGGTACTGGAGGCGCGAGGTTAAGATCTCA
AAGACGCCGCCGCCGACCGTGCCGCAGCCAAACATACCGATGCGCAGCGGGCCGCTCATGCTGGAAGATTGCGCAATTCGAAAATGATCCCAAGCGGTAT
GTGGCAAGTCCGGATATCCGTTATCCGGATACGCCGCCGGAAGATTCTTGCGGACTCGCCACTCGACAAGTTTGTGCATCTTTGCTGTCCACTGCATTGA
GAGAGCTGCATCGTTGGTATATATTCCCTAGCCCTCAAACTATAATAGTTGAGTAGTAGGAGTACCGTCAACGCTTAAAATACAATGAAAAGGCGGCGGC
GACATGGATCGATGTGGGTCCGACTTGCAGCCGCCACCTCGAGACCTCGAGACCTTGAGTCGACGAGACCATCGTGCTTGTCTACACGCACCGAGCAGTG
GCTATAACATGCACGCATGACAGTCGTCGTTGGAGGTCACCGCGGCGGGCGAACTTGAGCGATCCTTGGCCACTTGCGCCGGCGACGGTGCACTCTCCGC
CCGTGTCGCACGCACCCAGATGCACGAGATCGGCTTGAGCCCACGAGTGGCTACGACGCCAGCTCTCAGC