Description :
From Genome Similarity Track
Location :
Scaffold_1091:4196- 7181
Sequence
2985 bases(100 bases per row)
ATGGGTTGTTTGGGCGGACACGGGCTTTCTTTGCTGCGACAGAATCCCAAAACTCTACTGGCGATTTGCACTGTCACATGCTGGTCTGGATTGAAGGTAT
GCCCCAAACCGTTGATGAGTATTATGAATCGTGCAAGTTCTTGGACTTTCGCAATCGTGTTCTTGCGTATGTTGCATCGATAACGAAAGCAACATTTCCC
GTTACGAATGATGTTTGCCCGCAATGTGGGGAAATCCAACTTAGTTCACGTGAAATGTGCGAGGAGGCATTTAAAAAGGCTCGAAGTGGGGCTTCGAGAA
CAACAACTTCAAAATGCGTATCGTGCCAGTCGTTTTTCGGAGCGAATGAGGTGATTGAAGGCCAAATGAAGCGATTAGCAAGAAAACGTTCTGCGCCCAA
TACTGAATGGTGCTCTGAAATGGTACGCCTATATTTGGCTCATCCTCATCCGCTGCCTCTTTCCCCCCAGTCGGACAAGAAGTAGTGTGTTTGCTAAGAG
AATCAGCAGCATTACTTTACTTTCAAACTCATGACTGGTTTCGCCGCCGCTCTTGCTTCAAGAAAACTCGGCGTACACCAAAAGCTACTATATGCCGGAT
GTTCTTCCCAAAACCAACCTCCCCGTCGATACGATGGCTGGCTGATGGGTCAGTGGAAACAGAGCGTCGTATTGGATGTGAATATCTTAATACCTACTCT
CCTGTCCTGGCGAAAACCTTTAAGTGCAATCATGACTTTTAAAGCTTCTTACAGCCGGAGATGGTCCAGAAAAAGCGTTCTATATGCTCAAGTACACAAT
AAAAGAACAAAACACATTGGAAAACCCCCTGGCAATTTACATGCATGCATTTGACAAGGCTACGTCAAAGAGGACCCCGTCGGAATCGGAGATTGAAGCG
GGCAAACGCTGCATACAATCAATGTGTTGTTTCCTTTCAAAACCACAAGAAGTTGCCGCCCCATTGGCAGCACGCTTTGTTATTCGTGCTTCCCCGTATT
ACACGTCTACCGAATTCGTGAAAGTGTTTCTGAGCGCGTTTGTGAAATTCATTTTTACTGAGGAATCCTGTGACGTAATGCTGAGATGTAGTAGCTCGAC
AATGACGTACAAGCCAACGAGCGCCGTTTTTGACTATATCTATCGACCCGATGTGCTTGAGATGGCGTCTCTCATGGACTTCACAAAATATTGGAAAAAG
GAGAATAATGTAAGTGGAGAGCGCTTCCTTTCCAATCACGGTCAAGCTACTACTCATAGTTTACACAGAAGAAAAATTCCTGCAGTCGCTACCCTCATTG
GAAATCGATTACCGGATGCTCGATCGGGCAACGTGGAGCTCGAGGCACAACTTACGCTTCAACAATCTTTACTGGTACTGTTTAAGCCGTTCCGACGACG
TGGGGATTTTCCAAAACAAAACCTCAGCGATTTTTATGTAAAATGGTGGAGACATGAAGCACCTGAAATTGCCCGTCAGCTCTTACAGAACTCCAACGAT
AACTATACGTCGCGAGAAATTAGCGAGGAAACGGTCAGATGCCAATATGGAGCAATTTAGAGCTATGGTGGATGGAGATGATTACTCAGACGACGGCAGC
AACTACGGTGCGTTGGAGCAAGCTGAAGAAGCAATTTGTGTTGATGGCTCAAGTGATGACATCCCAGAATCTTATTTTTTTTTTTTCGGCATCGCCTACT
ACAAAAAGATATCACTACTAGAGTTAGGGGAAAAGTGATCGATGCTTGCAGCAAGCTCGAGCTGTCTCACTTTTAAGCAGGATAATCTGGCGATACCACA
GCTTTCTGACGATGAATGGAGGTCACGAATTGCAATGGCTGAAGAAAAATCAACATTGCCTGCATTGAATGACGAGACACTCGTGCAACGCTCTGATAAT
CCCACTCGCGTACGAATGGTTTTTAATAATGGTGAGAATGATGAGTATTGGCCGAATCCTTTTGACACCGGAAGTATTGGAAATACAATACTCCATGCGA
ACGCATCACTCCGAGAGGTGTCAGCTTGTTTTCAACTGGACCGTAAGCAAGACAAAATGTTTGTTCGCGCTGGCTCAAGATTATTGCAGTCATTGACAGC
CGCAAGTTGTGAAAACGTGGATCAAATGATTGGGTTTTTAGGCGGTTCCCCAGGAACACGAAAAAGCTTAGTAATTAAAGCTCTCCAAGCCCTTGCAAAA
TCTTGGGAAAGCTCAGATGCAGTTGAAACAGTGGCATATCAGGGTGTTGCTGCGAAGGCTGCAAATGGACAGACCATCCATAAGCTTTTTCAATGGGGGA
TAAACACGAACATGATGTCGAAGCCAAACAGTATTCAACAGCGAGAGCGATTTGCGTGGTTAAAGAAGCTTATTATGGATGAAACATCGACTACAGATGT
TAAGTTTATTGGAATGATGGACCAAGCGCTACGTGACTTAAAGCAGAAACCGGATGTATTTTTTGGTGGAATTCACGTCCTATTTGTGGGCGATTGGCTT
CAACAACCCCCGGTTGCTGGTGTTCCGGCGTTTGTCGACCATCCCCCACAGCCTACGTCTAACCCGACCTCAAGAAACAACATTACCACCTATTTTGCGA
GAATACGCGGAATTCAGGCTTACCAACAGATAAACGAGGCAGTTTTTTTCGAGGAAAACATGAGACAACGAGCAGACCCAAAATGGGCCGAAATTCTCGA
GAGATGGAGATATGGGAATTACACTGAAGACGACATCGATTACGTGAATAACCAATGCTACAATGATAACTGGAATTCGTCTGCAATGGATACTAAATCG
TTCTGTCCGATTATCGTCACTTCGAACACGCTTCGTTGTGAATTTAATGATCAATCGGCAGAATGTTTTTGTTGTCGTCAGTCCAAAACCTTGTATCAGT
ACCCCGCCATTATTTCGAAGCCTCGTTTCCAGATATCCCGATCCCAACAAAGTAGCTTAAAGAATATTCGTGACGACAAAAATGG