Description :
From Genome Similarity Track
Location :
Scaffold_218:4196- 5376
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_218-snap-gene-0.13Gene of unknown function

Sequence
1180 bases(100 bases per row)
CGCCATGCGCTTCGAGGAGCTCGCGCTCAACGGCAGTCTGCACTCTGGCGTGCTGCTGGAGCTCGCTCGTCTGCAGGATCAGCTCGCCGCCATGACGTCC
CAGCTCGACGCCGAGCGCGCATCGGCCGGCGCAGCACGGACGGAGCGTCAGGTCGTGCAGCGCAAGGCTCGCGAACTGGAAGAGGCGCTCGTCCTTCGAG
AGACGCACATCGCCGCGCTTGAACGCGAGCGCGCCGACGGCGCCGAGCAGCTGACCGCTCTGTCGAGCCGCGCGCAGTCGCTCGCCGTCGAGAAGGCGAC
GCTGCTCAAGTTCGTGCAGGAGCAGGCCGAAGCCAAGTTCCAGCTCGATGCGCGGCTGCAGCAGGTGCAGGACGCCAAGGTCGTCGAGCTCTCGGCTCTG
CACGCTAAGCTCGAGCAGGCCGTCGAGATGAAGCACACGTTCAGTCGACAAGCCCTTGAGGCAGAGCGCAACGTCGAGCTAGCCCGGCGAGAGCTGGAGA
CGGCGCGAGTTGAGCTGCAGGAGCAGCAGATCGAGGTCGGCGAACTCCAGCAGCGACTGCAATTGCTGGCGGACGAGTTGAAGAGAGCCGCCATCGAGCG
GTCCAGGCTCGAGGACGAGCTCGTAGCTGCGAAAGACGTGTGTCGAGACCTGCAGGGTGAGCGCGAGCGATCAGACCGTGAGATTGTGGTGCTGCGCGGC
AGTATCGCAGCGATGGAGGAGACCCAGCGCGACTTGGAGAAGCAACTTGCTCGCCAACGAGATGACGATGCCGCCCTGCGTTCTGCCCTGGAGACGTCCC
TGCGGGATCTCGAGGCTCTCTCGCACCAGCGCAACGAGGCCGCCAAGGCCATGAACGAGGCCGTGACCATCAGCGCGTCGTCGCTCGAGGAGCAGCAAGC
GCTGGAGTCCAAGGTCGCCATCCAGCGCAAGCAGCTCGAGCAGCTCAAAACCGCCAAGACGCTGCTGCAGAACGCCATGCTCGAGCAGCTCGCCGCACTG
CGAAAGCAGCTGCATGCCGAGCGCGCGCGTCGTGTCGAGACGGAGGCCAAGCTTCAACAGATGCTCCAGTTCTCGAGCTCGAACTACAGACAAGTGCCGT
CCTCCAGTGCTGAGCAGAGTGAGGAGCGGGGAAAGCCGCCGTCACCGTCGCTCGCGCCGCAGCTGCCCGACTTCGTAGCC