Description :
From Genome Similarity Track
Location :
contig_26:419561- 422307
Transcript NameFunction/comments
g5492.t1conserved hypothetical protein
g5493.t1hypothetical protein PHYSODRAFT_501414

Sequence
2746 bases(100 bases per row)
AAGCAACCTGCGCCACGTGGAGGTTGTGGCTCTCAACGCCCTTGAGCATCAGTTCGCTGCAGCACGTCGCTACTAGCGTGTCCACACGTCAGCATAGCCA
CGGGTAGAGATGACGCCGATCTGCAAACTTGACCCATCGAGTTTGGCCGTCGCCTCAACGCCGGGCTCTTCAATCAGCAGGGGCCTCGGAGCACCAGAAA
CTTCCTCGCTTGCCGCTTGGCCAGCTTGGTGGTGGCGATGAGGGTTACCACGGCGGTGATGTCGACGACGGCGTGAAGCCTTAGCGCTGGCCGGGTGGTT
TGCTTCCTCCATTCAAGCAACAGCTCAAGCAATTTGCTTTGTGCTGCTGTTTGAGCTGCAGCGTGTACGTGTACTAACAAGAAAAAGACCGTTGGCGGTC
AAGCCAACACAGCTCTTTTCCCACGAACCCATCACAGCGAGAAGACCCGCTTCACACGAGGCAGTTGGCATGAAAAACAATCCTCGTCGCTTCACATTAT
CATTACACGACACCCATCGTACCTCTTCTCATTTGCTGCACACAGTTCTCTATCGAAACGTCCACCTCGTGCTTAGTCCGTGGTAAGGAACTTGACGCCG
TCTTCCTCGCACGTCTCGCCGGCAATCACCGCAGCCTGCAGCAGCAATTCATGAGCCAGCCGCCTAGCAAAGCCACAAGCAACCACGGGAGCGTACCTTT
CCTTCTCCCTCCAGCACTTTGAGTGCCTCTCGCAGCAGCCAGGGCTCCATCCCGTGGATATCTACCACAAAGCAGCCCGCAATGAGTTCCCCACTCCCTC
TTGTACAATTTCCTCTTCAACTTACTCGTTCCCAGCGTCTCCTCTCCAGCATACAGCTCGTACACCGTAAACACATTGCCCAGCATGCCGTTCTCTTGGG
CCTGAAATGAAAGCACCATATACACTCGCGTATAGTCACCACACGATGCAATCATTGCAACACAACAAGAAAACATACAAAGTCGTAGATCTCGGCCGCC
CACTCGGCCGGCTTCTTCCACATAATGCGACAGCGCGTCTTGGTGTCGTCCTCCATCGGCCGTGCCACAGCGCACCAGGTGTTCCACCACGGCCAGACGT
CCGTCCTGTGCCATGTTGCGGCTGATTTTCACGTTCTCAAAGAGCGACGAGGTGAAGGGCTGGAAGATGGGCAGGTCGTGCGCGCGGTGGTATTCGAGCA
CGAGCTGCTGCCACAGCACGAGCTGCTTCTCGCGCGTGGCGCGCACGGGCTGGAGCCTGCGGGGGATTCATAGTAAATTTCACATTTCCTAACGTTATTT
ATTTGTATATATATAGGACCCAGTATTTTTATAGGTTGGGGCAATGCGGACACGTACGTGAAGAAGGGAGGGAAGTCGTAATACTCCGGGTACGAGAACT
TGTCCATGGCGGCGAGGAAGCGGAGGCTGATGGTGATGTGGCGCAACTATTCCTTGAAATGAGATTTGTAGGTTAGAATGGGTACATTATTTATAGATGG
ATGTAGCTTTACCTTGAAACTAGTGTAGGATGGAAAGCACTTGCTCCTTCACATTGCCGCCTCAATCTCACCGATGGCACCGTCCTGCGCTATGAGCGCG
TGCTCCAGCACAAAGGCTGCATCATCGATCGTCCCGAGCAAGTGGAGAAGCGAAGGTAGAAAGTCGACTGTAGTCTCCAATCGCACCACTCGCTTGCTCG
CTTCATCCCATTCAAAGCTGAGGCGGCACGGGAGGCAAAGACGCTGGCCCAGCAGCTTCGACCTCAAAAGGGCGGTCTTGTCTTCTTGGCTCGTGTTGTA
CTGGCCTCCGTCGCCTCCCATCAGGTGTGGAAACACGTTTTGCATGGTCGAGCCCGAGATCGTCACATTGAGGGAGCCGGTGGCCGTAGTGAAGTCGTTG
GAGATTCTAGTCATGTGTTCCAGCTGGAACTGCAGGTCGTCAAAGTAGCTCGTGCACCGTTCCCACTGCTCCACGAGCGCATCTATGCCTCGCCGCTCTC
CCAGCATCACGTCGCTTGCCACGGATGTCTGCAGGAACACGAGCTGCTGCTGTGCTTCGGACTTTTGGAGCCAGGCCTCTGGACCAGGGGATACCTGGCG
GCTAAGTCGAGTTCCGTTGCGAAAGAGGTGGAAGTACTCGACCACTACATACCACGCGCTCGACTTGGCGTTGGAAATGAGTCGGCTGTGTTGCATCTCC
AGAATCGGGATCTCGCGCTGGAGCTGCTCTACGCTGGTCTCAGCTTCCTTCGCCTGCTCCGACTGTTTCTTCCTGTAGCGAGCCTGATTCGTGCGGCACT
GCTCGCGCCGGCGGGGGGTCTTGATACGAATTCGCTTGCGCTTAGGCTTTGCGGCATTTGATCCGGCGCTCCGGATTGTTTTGACGGAAGGCACCGTCCT
GGATGTAGCTACCGGCTGCGGGAGTGGCTGGGTTGGGTCGAAGAAGCAAACGGAATCACTGGAGGCTTAGCGGTCTCGTGCTGCGTCGCGGGAGCGTTTC
GTAGGTGCCGTTGAGTCTTTGGTCGCCCGTCGAGCGAGCGATGCTTCCATCAGATAGTCGAGAGGTGTCTGCTGCGCCAGGCTTGTTGCCTTCGGCGTAT
TGAATGCAGCGGCTCGCGTCGGTGGGATTGGCGGCAACGCCTTGATGAACATACCGCCGCCACCGACGGTCGCTCGTGGCAGCACGTGCCCGATCACGTC
GGACGTGAGAGCGTGTGTCGCGCGGCCTAGCTCGACGCGCGCGAAT