Description :
From Genome Similarity Track
Location :
Scaffold_47:419556- 421821
Sequence
2265 bases(100 bases per row)
CCCATACTGGTAGTACGGCCTAAGGGGACAGACGTAGAAGGTAGGATGCGTGCGCATCTTTCCTGGCAGTTCAATCGTATATGCGCTGCCTAAGCGGCGC
GGCACACAAAATGGACCGATGAACTTGGGTAGTAACTTTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAAGTA
GCCTTTATTGAATAAAAGAACATTCTCCCTTCCATTCTTGCCAGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGTATGAAACGGACA
ACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTATCTTTGGCTATAGTTCGCTTGGAGCGCACTGCGGCAAGATCAGTGACCTGGGTAGTAA
GAGCATCCTCGCTCTTACTTTCCTCTTCTTCAACAAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCGCATTGTCAGCACGTGACGAGTGAGA
GCCGGATTGACGGTCGCTCTAATGAGTCTCTCCCCTCCTTAAACTATAGTCACACTCTAAAAAGGTGGGATGAAGCGGATTGCGCAAGCCATTCACGAAG
AACGGCGTGTTCTTCATCGACGCATGAACTGAATTGTTGATGGCGAACTCCACCATCGGCGAGAATTAGCTCCAATTTGTAAAAGAATGGACGTATCCTT
GAAGAATATCCTCGAGGACACGATTGGCGCGTTCGGTCTGACCATCTGTTTCAGGATGGTCGGACGTGAACATATTTAAGCACGTTCCGAGTGTTTTGAA
AACGGAACGCCAGAACTCGGCTGTGAATCGCGGGTCTCGATCGGACACGAGTTCCCGAGGCAACCCATGAAGGCGAACGACCGTGTCGATAAAGACACGG
GCACAAGTCGATGCGTTGATTGATTCGGGTACAGCAACCAGATGGACCATCTTGCTGAACCTGTCAACGAGCACAAGAATACCAGTATTCTTGTGAGAGT
CTGCGGGGCATCCGAAGACAAAGTCCATTGAGACAGATTCCCAGCACTTTTACGGGACGGGTAGAGGTTTCAATGGGGCTTGAAGGGAAGGACAAGACTT
TACCCATAGGCAGACCTCACAGGCCCGAACGTACTTGCGCACGAACTGATACTGGCGGGGACAGTAAACGTCGCGGCTCACTGTGAGATATATTTTCTCA
CGACCACGATGTCCACCAACAGGTGCGTCGTGGTACTCATACATGATACGCAATCGCAGATCACCATGATCTGGTACGACGACACGAGTTGTGTCGCCGG
CAACAGAAGAGTATTGAAGTAAGCCATTGCGAACTGTATATCTATCCGTAGAGGATAGATATACTGACGACAACTACTTGAGGCTCTTCCCGGATGGGTG
CGAGAGATGATGCATCAATCGCACCATTTCCGGATCATACGCCTTTCGTATGTCTTCCAATAAGGTTGGCGACGGGACACTCGACGTCAACACCGCAACA
GTGGTCGGACCAGTGTCGGGTGGCGCAGCCGGTTCGAAATCGGGCCGGCGCGAGAGTGCGTCAGCAACGATGTTAAGTTGTCCTGGATTATACTCGACGG
AGAAGTTATACTCCGCAAAGAATGACAGCCACCTCGCCATCCGCTGCGAGAGGTGTGGACTGTTTACGGCCGTGCATAAATACGCATGGTCCGTATAAAC
GATGAAGGGTCTATTACCTAGCAGATAGACTCTGAACTTAGCCAGCACGTACTTAATGGCAAGGCGTTCGTTGTCATTGACGGGGTAGTTGCGTTCAGCT
GGTTGCAGCTGGCGTGACTAGTAACAGACGACACGCTCCGCATCGTACTGCATTAATGCACAGCTGATTGTAAAGTCGCTGGCATTACAGACCACGTGAA
TTGGCCTGTCTTGGTCTACAATCGCCAAAACTCGTGATCGTATCAAGCTTTTCTCGATACCTTCGAAAGAGCGCTGGCAATCGGCACTTCATTCCCACTC
CTCGTCCTTTTTAATAAACGAGAGAGATGGACAGTCATCTCGGCGTAACTGCGTGAATATTTGCGCAAGTATGCCGCTAGGCCAAGAAACTTTCGAAGTC
CCTTGACATCTGTAGGTACCGGCCAGTCGGTGATCGCCTTGATCTTTTCTGGACCGGGCCGGAAGACATGCTTGCCCACGATGCAAGCAAGAAGTAGTAT
TTTGCTAGCAGCAAATATACACTTCTTGAGGTTGGCGTACAACTTATGCTTGCGCATTAGTGTAA